Author Archives: author

Impact of the COVID-19 Pandemic on Breast Incidence and Stage during the COVID-19 Pandemic in the Netherlands, and a Comparison with Other Countries

DOI: 10.31038/AWHC.2023643

Short Report

In the Netherlands, the first COVID-19 patient was confirmed on February 27th, 2020. Thereafter, the number of infected patients quickly increased, just as the number of hospitalized COVID-19 patients. In March, 2020, the first policy measures were taken to prevent the spread of the virus. Those measures included, amongst others, the recommendation to keep 1.5 meters distances and for elderly and vulnerable people to stay at home. Additionally, the Dutch national breast cancer screening program was suspended in week 12 of 2020. In week 26 of 2020 it was resumed at 40% capacity, which was slowly increased to a capacity of 100% in the spring of 2021. These policy measures and decisions in healthcare were made without, or with little, prior knowledge of the consequences on breast cancer detection and care. Therefore, this short report aimed to give an overview of the effect of the COVID-19 pandemic on breast cancer incidence and stage in the Netherlands, and compared those results with other countries.

First results of the effect of the COVID-19 pandemic on breast cancer detection showed a decrease in breast cancer incidence (expressed as the number of breast cancer diagnoses per 100,000 women) in women diagnosed with breast cancer in weeks 2-17 of 2020, compared with women diagnosed in weeks 2-17 of 2018 or 2019. This effect was seen in all age groups and tumor stages, except stage IV [1-3]. As expected, the incidence of DCIS and stage I tumors decreased to the largest extent, as these are the tumors mainly detected by the breast cancer screening program.

When we focus on women in the screening age, 50-74 years, 67% fewer screen-detected tumors were diagnosed in weeks 9-35 of 2020, compared to week 9-35 of 2018/2019 [4]. The incidence of screen-detected tumors was significantly lower in all age groups during weeks 14-35 of 2020, and the incidence of all tumor stages, except stage IV, was significantly lower during weeks 14-25. During weeks 26-35 the incidence of DCIS and stage I-II tumors stayed significantly lower. Less pronounced effects were observed for the incidence of clinically-detected breast cancer. Compared to weeks 9-35 of 2018/2019, 7% fewer clinically-detected breast tumors were diagnosed in weeks 9-35 of 2020. The incidence decreased in all age groups in weeks 12-16. Incidence of stage I-II tumors was significantly lower in weeks 12-13 and incidence of DCIS and stage I-III tumors was significantly lower during weeks 14-16.

Follow-up research of our group investigated the effect of the pandemic on breast cancer incidence and stage during January 2020 till December 2021 [5]. This study showed that the incidence was significantly lower in women eligible as well as not eligible for screening (i.e., those aged <50 and >74 years). This suggests that the decrease in incidence was caused by both the suspension of the screening program and the reluctance of patients to visit the general practitioner. During the second wave, i.e., October 2020-April 2021, the incidence of clinically-detected tumors was significantly higher in Dutch women aged 50-74 years [5]. This suggests that the method of detection in some women changed from screen-detected to clinically-detected. Additionally, a small and temporary increase in the incidence of stage IV tumors was seen in Dutch women aged 50-69 years. However, it is unclear whether this increase is due to the COVID-19 pandemic or other factors. The increased incidence could also be a result of the increase in the usage of improved diagnostic methods, such as the PET-CT scan which is highly accurate in detecting distant metastases compared to conventional methods [6].

Comparable to our studies, studies from other countries also showed a decrease in both the absolute number of breast cancer patients [7-14] and in the crude breast cancer incidence rate [15,16] at the beginning of the pandemic. The largest decrease in breast cancer incidence was seen in women in the screening age groups [3,4,8,16]. Part of the decrease in breast cancer incidence can be explained by the suspension of the national breast cancer screening program. Many countries had to suspend their screening program to reduce the pressure on healthcare [17]. A previous meta-analysis showed a 41% decline in mammogram rates between 2019 to 2020 according to data of three registry-based studies, and a 53% decline based on data of ten non-registry-based studies [18]. Another part of the decrease in breast cancer incidence could be explained by a decline in the number of women visiting the General Practitioner (GP) due to fear of contracting the virus or overburding the healthcare system [1,2]. The decrease in the number of women visiting the GP in the Netherlands did not differ by age group [2].

Studies from Norway and New Zealand only showed a minimal decrease in the number of breast cancer diagnoses during the start of the pandemic [5,19]. Both Norway and New Zealand had a low COVID-19 infection rate and low COVID-19 death rates compared to other countries [20-25]. This indicates that the stable incidence in Norway and New Zealand could be due to the low severity of the pandemic, resulting in a minimal decrease of breast cancer diagnoses.

Comparable to our results, some studies from other countries showed that breast cancer incidence quite quickly reached pre-COVID levels after the first wave [7-9,14-16]. However, a couple of countries/regions had more difficulties in reaching pre-COVID incidence levels. These include Italy [10], Hungary [11], the United States [12], and Bavaria [13]. The level of political regulation and the number of COVID-19 infections or deaths were comparable between those four countries/regions and other countries [26-28]. Hence, this probably does not explain the difference in incidence. One reason for the decreased incidence in Italy could be that Italian women were still hesitant to visit screening after the end of the first wave [29]. A Italian study showed a 20% decrease in the number of women attending screening between October-December 2020, compared to the same period in 2019, while the number of women invited reached pre-COVID levels [29]. The decrease in incidence in Hungary might be explained by the relatively high number of COVID-19 patients in the hospitals, compared to other countries [30]. Also, the breast cancer screening program was suspended a second time in April 2021. The decrease in Bavaria (Germany) could have been caused by a relatively high number of patients at the Intensive Care Units (ICU) in Germany during the second wave, compared to other countries [31]. A negative association between the number of patients at the ICU and the diagnostic capacity at the oncological care was found in Germany [32]. The potential cause for the decrease in incidence found in the study from the United States is unknown. These cross-country comparisons show that the cause for the decline in incidence varies from country to country.

In the Netherlands, the maximum allowed screening interval between two invitations increased from two to three years in November 2020. The increase in the screening interval was both due to the COVID-19 pandemic and due to a shortage in mammography technologists. As a result, the mean screening interval was 32.2 months in 2021 [33]. This increased screening interval probably caused the method of detection in some women to change from screen-detected to clinically-detected, as a significant higher number of women were diagnosed with a clinically-detected cancer during October 2020-April 2021 compared to the same period in 2017-2019 [5]. A Dutch modelling study showed that a three-months suspension of the screening program, without catch-up, might already cause a 19% increase in the number of interval tumors detected between the last and first screening after interruption, compared to no suspension [34].

The majority of studies on tumor stage investigated whether the proportion of women diagnosed with a certain stage tumor changed during the pandemic [10,21-25]. However, as the suspension of the breast cancer screening program mainly led to a decrease in the incidence of DCIS and stage I tumors it was expected that a lower proportion of women would be diagnosed with these tumors, and that a higher proportion would be diagnosed with late-stage tumors. It would have given more insight if these studies investigated the effect of the pandemic on the incidence of breast cancer by tumor stage, as we did in our studies.

In our studies we did not adjust for the aging of the population or the increase in risk factors associated with breast cancer, while those factors might have led to an increase in the number of cancer patients. However, as the crude breast cancer incidence rate stayed rather constant in the Netherlands during the seven years before the pandemic (2013-2019) [35], and the study period used in our studies is relatively small, it is not expected that this influenced the results.

This report showed the effect of the COVID-19 pandemic on breast cancer incidence and tumor stage in the Netherlands, and a comparison with other countries. More studies on the effect of the COVID-19 pandemic on breast cancer incidence, both in total and per tumor stage, are needed to determine the association between delays in diagnosis and tumor stage.

References

  1. Quinn-Scoggins HD, Cannings-John R, Moriarty Y, Whitelock V, Whitaker KL, et al. (2021) Cancer symptom experience and help-seeking behaviour during the COVID-19 pandemic in the UK: a cross-sectional population survey. BMJ open 11: e053095. [crossref]
  2. Grant MP, Helsper CW, Stellato R, van Erp N, van Asselt KM, et al. (2022) The Impact of the COVID Pandemic on the Incidence of Presentations with Cancer-Related Symptoms in Primary Care. Cancers (Basel) 14: 5353.
  3. Eijkelboom AH, de Munck L, Peeters M-JTV, Broeders MJ, Strobbe LJ, et al. (2021) Impact of the COVID-19 pandemic on diagnosis, stage, and initial treatment of breast cancer in the Netherlands: a population-based study. J Hematol Oncol 14: 1-12. [crossref]
  4. Eijkelboom AH, de Munck L, Lobbes MBI, van Gils CH, Wesseling J, et al. (2021) Impact of the suspension and restart of the Dutch breast cancer screening program on breast cancer incidence and stage during the COVID-19 pandemic. Prev Med 151: 106602. [crossref]
  5. Eijkelboom AH, de Munck L, Larsen M, Bijlsma MJ, Tjan-Heijnen VC, et al. (2023) Impact of the COVID-19 pandemic on breast cancer incidence and tumor stage in the Netherlands and Norway: A population-based study. Cancer Epidemiol 87: 102481.
  6. Paydary K, Seraj SM, Zadeh MZ, Emamzadehfard S, Shamchi SP, et al. (2019) The evolving role of FDG-PET/CT in the diagnosis, staging, and treatment of breast cancer. Mol Imaging Biol 21: 1-10. [crossref]
  7. Gurney JK, Millar E, Dunn A, Pirie R, Mako M, et al. (2021) The impact of the COVID-19 pandemic on cancer diagnosis and service access in New Zealand-a country pursuing COVID-19 elimination. The Lancet Regional Health-Western Pacific 10: 100127. [crossref]
  8. Peacock HM, Tambuyzer T, Verdoodt F, Calay F, Poirel HA, et al. (2021) Decline and incomplete recovery in cancer diagnoses during the COVID-19 pandemic in Belgium: a year-long, population-level analysis. ESMO open 6: 100197. [crossref]
  9. Ramanakumar AV, Annie B, Frederic L, Christine B, Cathy R, et al. (2022) Evaluating the impact of COVID‐19 on cancer declarations in Quebec, Canada. Cancer Medicine 2022. [crossref]
  10. Mentrasti G, Cantini L, Vici P, D’Ostilio N, La Verde N, et al. (2022) Rising incidence of late stage breast cancer after COVID-19 outbreak. Real-world data from the Italian COVID-DELAY study. The Breast 65: 164-171. [crossref]
  11. Elek P, Csanádi M, Fadgyas-Freyler P, Gervai N, Oross-Bécsi R, et al. (2022) Heterogeneous impact of the COVID-19 pandemic on lung, colorectal and breast cancer incidence in Hungary: results from time series and panel data models. BMJ open 12: e061941. [crossref]
  12. Drescher CW, Bograd AJ, Chang SC, Weerasinghe RK, Vita A, et al. (2022) Cancer case trends following the onset of the COVID‐19 pandemic: A community‐based observational study with extended follow‐up. Cancer 128: 1475-1482. [crossref]
  13. Voigtländer S, Hakimhashemi A, Grundmann N, Radespiel-Tröger M, Inwald EC, et al. (2023) Impact of the COVID-19 pandemic on reported cancer diagnoses in Bavaria, Germany. J Cancer Res Clin Oncol 2023: 1-11. [crossref]
  14. Vrdoljak E, Balja MP, Marušić Z, Avirović M, Blažičević V, et al. (2021) COVID‐19 Pandemic Effects on Breast Cancer Diagnosis in Croatia: A Population‐and Registry‐Based Study. The oncologist 26: e1156-e1160. [crossref]
  15. Caswell-Jin JL, Shafaee MN, Xiao L, Liu M, John EM, et al. (2022) Breast cancer diagnosis and treatment during the COVID-19 pandemic in a nationwide, insured population. Breast Cancer Res Treat 194: 475-482. [crossref]
  16. Greene G, Griffiths R, Han J, Akbari A, Jones M, et al. (2022) Impact of the SARS-CoV-2 pandemic on female breast, colorectal and non-small cell lung cancer incidence, stage and healthcare pathway to diagnosis during 2020 in Wales, UK, using a national cancer clinical record system. Br J Cancer 2022: 1-11. [crossref]
  17. Perin DMP, Elfström KM, Bulliard J-L, Burón A, Campbell C, et al. (2021) Early assessment of the first wave of the COVID-19 pandemic on cancer screening services: The International Cancer Screening Network COVID-19 survey. Prev Med 151: 106642. [crossref]
  18. Ng JS, Hamilton DG (2022) Assessing the impact of the COVID-19 pandemic on breast cancer screening and diagnosis rates: A rapid review and meta-analysis. J Med Screen 29: 209-218. [crossref]
  19. Mitchell H, Mclean J, Gavin AT, Visser O, Millar E, et al. (2023) Impact of COVID-19 control on lung, breast, and colorectal pathological cancer diagnoses. A comparison between the Netherlands, Aotearoa New Zealand, and Northern Ireland. BMC Cancer 23: 1-8. [crossref]
  20. Our World in Data. Total confirmed COVID-19 deaths and cases per million people. https://ourworldindata.org/grapher/total-covid-cases-deaths-per-million?time=2020-01-04..2021-12-31&facet=metric&country=NOR~NLD. Accessed 22-09-2023.
  21. Rocha AFBM, Freitas-Junior R, Ferreira GLR, Rodrigues DCN, Rahal RMS (2023) COVID-19 and Breast Cancer in Brazil. International Journal of Public Health 2023: 48.
  22. Kang Y-J, Baek JM, Kim Y-S, Jeon YW, Yoo T-K, et al. (2021) Impact of the COVID-19 Pandemic on the Diagnosis and Surgery of Breast Cancer: A Multi-Institutional Study. J Breast Cancer 24: 491. [crossref]
  23. Purushotham A, Roberts G, Haire K, Dodkins J, Harvey-Jones E, et al. (2021) The impact of national non-pharmaceutical interventions (‘lockdowns’) on the presentation of cancer patients. ecancermedicalscience 15: 1180. [crossref]
  24. Li T, Nickel B, Ngo P, McFadden K, Brennan M, et al. (2023) A systematic review of the impact of the COVID-19 pandemic on breast cancer screening and diagnosis. The Breast 2023. [crossref]
  25. Knoll K, Reiser E, Leitner K, Kögl J, Ebner C, et al. (2022) The impact of COVID-19 pandemic on the rate of newly diagnosed gynecological and breast cancers: a tertiary center perspective. Arch Gynecol Obstet 2022: 1-9. [crossref]
  26. Our World in Data. COVID-19 Containment and Health Index. https://ourworldindata.org/grapher/covid-containment-and-health-index?tab=chart&time=earliest..2021-02-28&country=USA~ITA~NLD~HUN~BEL~DEU~CAN~NOR~NZL~HRV~GBR. Accessed 05-25-2023.
  27. Our World in Data. Biweekly confirmed COVID-19 deaths per million people. https://ourworldindata.org/grapher/biweekly-covid-deaths-per-million-people?tab=chart&time=2020-01-15..2021-03-08&country=USA~GBR~ITA~NLD~NOR~NZL~HRV~HUN~BEL~DEU. Accessed 30-05-2023.
  28. Our world in Data. Biweekly confirmed COVID-19 cases per million people. https://ourworldindata.org/grapher/biweekly-covid-cases-per-million-people?tab=chart&time=2020-01-15..2021-12-31&country=FRA~DEU~ITA~USA~NOR~NLD~GBR~HRV~HUN~CAN~NZL~BEL. Accessed 26-06-2023.
  29. Rossi PG, Carrozzi G, Falini P, Sampaolo L, Gorini G, et al. (2023) The impact of the COVID-19 pandemic on Italian population-based cancer screening activities and test coverage: Results from national cross-sectional repeated surveys in 2020. Elife 12: e81804. [crossref]
  30. The New York Times. Europe’s Deadly Second Wave: How Did It Happen Again? https://www.nytimes.com/interactive/2020/12/04/world/europe/europe-covid-deaths.html. Accessed 25-05-2023.
  31. Our World in Data. Number of COVID-19 patients in ICU per million. https://ourworldindata.org/grapher/covid-icu-patients-per-million?country=CAN~DEU~NLD~ITA~USA~Wales. Accessed 05-25-2023.
  32. Arndt V, Doege D, Fröhling S, Albers P, Algül H, et al. (2023) Cancer care in German centers of excellence during the first 2 years of the COVID-19 pandemic. J Cancer Res Clin Oncol 149: 913-919. [crossref]
  33. Netherlands Comprehensive cancer organisation (IKNL). national monitoring of the breast cancer screening programme in the Netherlands 2020/2021. 2022.
  34. Poelhekken K, Greuter MJ, de Munck L, Siesling S, Brokken FB, et al. (2023) Long-term effects of the interruption of the Dutch breast cancer screening program due to COVID-19: A modelling study. Prev Med 166: 107376. [crossref]
  35. Netherlands comprehensive cancer organisation (IKNL). NCR Data. https://nkr-cijfers.iknl.nl/#/viewer/665a7495-c6fd-415c-9e62-afd630859b20. Accessed 22-02-2023.

Impact of BRCA1 and BRCA2 Gene Mutations in Prostate Cancer in Thies

DOI: 10.31038/MGJ.2023611

Abstract

Prostate cancer (CaP) is a public health problem among men worldwide, particularly those over the age of 50, and its incidence continues to rise. Despite improvements in early detection methods, a large proportion of patients succumb to the disease. Studies have shown that men with BRCA1/BRCA2 gene mutations in prostate cancer are likely to have more severe disease and a poorer prognosis. A BRCA2 gene mutation is known to confer the highest risk of prostate cancer (8.6 times in men ≤ 65 years of age) while BRCA1 presents an increased risk, albeit to a lesser extent (3.5 times); making BRCA genes a conceivable genomic biomarker for prostate cancer risk. It is in this context that we will examine the impact of BRCA1/BRCA2 gene mutations in prostate cancer in Thiès. Our study is conducted between January 2020 and December 2022 with 59 patients diagnosed with a prostate tumor in the urology department of the Thiès regional hospital and the Saint Jean de Dieu hospital in Thiès. The variables studied were age, PSA levels, Gleason score and histological grades. Total DNA from prostate tissue was extracted using the Qiagen protocol (Qiagen Dneasy Tissue Kit) and the three primers for the BRCA1-185delAG, BRCA1-5382insC and BRCA2-6174delT genes were amplified. The results indicate a frequency of 62.71% of patients diagnosed with prostate cancer versus 37.29% with the lesion of benign prostatic hyperplasia. BRCA1-5382insC and BRCA2-6174delT mutations showed higher frequencies (2-3 fold) in patients with CaP than in those with the BPH lesion, with 62.7% vs. 37.3% and 65.1% vs. 34.9% respectively. Gleason score 8 was more represented with a rate of 44% corresponding to grade IV according to WHO-ISUP 2016. However, individuals carrying mutations (BRCA1-5382insC; BRCA2-6174DelT) could be associated with a higher risk of prostate cancer, and are also likely to have a poor survival rate.

Keywords

Prostate cancer; Mutations; BRCA1, BRCA2

Introduction

Prostate cancer (CaP) is the second most common cancer diagnosis in men (14.1%) and the fifth leading cause of death (6.8%) worldwide in 2020 [1]. Every year, Africa records around 1.1 million new cases of cancer and up to 700000 deaths from the disease [2]. Many men with prostate cancer are diagnosed by a biopsy and analysis of the prostate, a prostate specific antigen (PSA) test and a digital rectal examination. Risk factors for prostate cancer include family risk, ethnicity, age, obesity and other environmental factors [3]. Demographic expansion and improved life expectancy worldwide are expected to contribute to an increase in the number of cases of CaP [4]. making it a major global health problem. Prostate cancer is a heterogeneous disease, both epidemiologically and genetically. The interaction between genetics, environmental and social influences results in lower estimates of prostate cancer survival rates by race, which explains the differences observed in the epidemiology of prostate cancer in different countries [3]. There is documented evidence of a genetic contribution to prostate cancer. Hereditary prostate cancer and genetic predisposition to prostate cancer have been studied for years. One of the most predisposing genetic risk factors for prostate cancer is family inheritance. Twin studies and epidemiological studies have both demonstrated the role of heredity in CaP [5]. Many researchers have investigated the possible role of genetic variations in androgen biosynthesis and metabolism, as well as the role of androgens [6,7]. Genomics research has identified molecular processes that lead to certain cancerous developments, such as chromosomal rearrangements [3]. Although new treatments have emerged in the last decade, prostate cancer is still a major source of cancer deaths in men [8]. Advanced age is the main risk factor, with more than three-quarters of CaP detections made in men over 65 [9]. Prostate cancer susceptibility genes are genes involved in the androgen pathway and testosterone metabolism. The development of the prostate epithelium and prostate cancer cells depends on the androgen receptor and testosterone signalling pathway [10]. The identification of cancer biomarkers and the targeting of specific genetic mutations can be used for the targeted treatment of prostate cancer. Biomarkers that can be used for targeted therapy include tumour biomarkers, DNA biomarkers and general biomarkers [11]. Family history and genetic predisposition such as BRCA1/BRCA2 pathogenic variants have also been identified as important risk factors [12,13]. It is known that a mutation in the BRCA2 gene confers the highest risk of prostate cancer in men (8.6 times higher in men aged 65 years, while BRCA1 shows increased risk, although to a lesser extent (3.5 times) [14]. These genes have attracted much attention from researchers, but their role in the clinical assessment and treatment of prostate cancer remains complex. The aim of this study is to examine the impact of BRCA1/BRCA2 gene mutations in prostate cancer in Thiès.

Materials and Methods

This study covers 59 patients with prostate tumours. These patients were recruited from the urology department of the Thiès regional hospital and the Saint Jean de Dieu hospital in Thiès between January 2021 and December 2022. Inclusion criteria were a suspicious digital rectal examination (DRE) with a PSA level greater than 4 ng/ml, followed by biopsies for histopathological diagnosis. After review in accordance with the rules laid down by Senegal’s National Health Research Ethics Committee (SNHREC) and in compliance with the procedures established by Cheikh Anta Diop University in Dakar (UCAD) for all research involving human participants, ethical approval was obtained for this study. The objectives of the study, the protocol, the benefits and the confidentiality criteria were explained to each patient to give them the opportunity to accept or refuse to take part. In the case of acceptance, a duly completed and signed informed consent form was required for admission to the study. For data collection, we collected demographic data (surname, first name, age, ethnicity, reason for consultation), PSA levels and medical history from routine family files.

DNA Extraction and Amplification of the BRCA1 and BRCA2 Genes

Total DNA from each sample was extracted using the Qiagen protocol (Qiagen Dneasy Tissue Kit). DNA quality was checked by electrophoretic migration on a 1.5% agarose gel. For a given gene, the conditions for DNA amplification are the same whatever the pathology and for both tumour tissues and controls. PCR amplification conditions included a 1st step of a 12 minute of initial denaturation at a temperature of 95°C, followed by a 2nd step consisting of 35 cycles of 15 seconds of denaturation and hybridization at 94°C and 57°C respectively, primer elongation at 72°C/1 minute, and a 3rd step: final elongation or polymerization at 72°C for 5 min. PCR products were checked by electrophoretic migration on 1.5% agarose gel from 5 μl of amplicons. The size of each amplified gene was estimated using a 500 bp SmartLadder size marker.

The primer sequences and corresponding amplicon sizes are shown in Table 1.

Three founder mutations in the BRCA1 and BRCA2 genes were identified for PCR: 185delAG in exon 2 and 5382insC in exon 20 of the BRCA1 gene, and 6174delT in exon 11 of the BRCA2 gene [15-17]. Germline mutations in the BRCA1 and BRCA2 genes have been reported in several studies of different ethnic populations [16,18,19]. For each mutation, three primers (one common, one specific for the mutant and one specific for the wild-type allele) were used. The competing mutant and wild-type primers were designed to differ in size by 20 bp, allowing easy detection of the PCR products by routine electrophoresis. Both the mutant (long) and wild-type (short) primers contain a mismatched base sequence near the 3′ end. The long (mutant) primer also incorporates two additional mismatched bases at two contiguous positions corresponding to the 5′ end of the short (wild-type) primer. During the final cycles of the PCR reaction, heteroduplexes can be formed from the short and long products, but the contiguous mutagenic sequences in the long product prevent the short product from being filled in using the long strand as a template. If a mutation is present in one of the alleles, two bands will be present. PCR conditions were optimised for each primer pair and applied uniformly to all samples. Amplifications were performed in a reaction volume of 25 μl. The composition of the reaction mixture is given in Table 2.

Table 1: Primers used

Primers

Primers sequences Amplicon size

BRCA1-del185AG

Foward  5′ggttggcagcaatatgtgaa 3′
Reverse wild 5′gctgacttaccagatgggactctc 3′ 335pb
Reverse mutant 5′cccaaattaatacactcttgtcgtgacttaccagatgggacagta 3 ′ 354pb

BRCA1-5382insC

Foward wild 5′aaagcgagcaagagaatcgca 3′ 271pb
Foward mutant 5′aatcgaagaaaccaccaaagtccttagcgagcaagagaatcacc3′ 295pb
Reverse 5′gacgggaatccaaattacacag 3′

BRCA2-6174delT

Foward wild 5′gtgggatttttagcacagctagt 3′ 151pb
Foward mutant 5′cagtctcatctgcaaatacttcagggatttttagcacagcatgg 3′ 171pb
Reverse 5′agctggtctgaatgttcgttact 3′

Table 2: Composition of the PCR reaction medium for each gene

Volume to be sampled for a PCR with a reaction volume of 25 μl.

Reagents

Gènes amplifiés
BRCA1-185delAG BRCA1-5382insC

BRCA2-6174delT

Water

8,75 μl

8,75 μl 8,25 μl

Master mix

12,5 μl 12,5 μl

12,5 μl

Fw

0,25 μl

0,25 μl 0,25 μl

Fm

0,25 μl 0,25 μl

0,25 μl

R

0,25 μl

0,25 μl 0,25 μl

Mgcl2

1 μl 1 μl

1,5 μl

Results and Discussion

Results

For 59 patients recruited, 37 (62.71%) were diagnosed with prostate cancer (CaP) and 22 (37.29%) with benign prostatic hyperplasia (BPH). With regard to the BRCA1 (185delAG and 5382insC) and BRCA2-6174delT mutations, the frequency of BRCA1-185delAG mutations in patients with CaP was 40% compared with 60% in those with a BPH lesion, indicating that this mutation shows no significant difference in men with CaP and probably does not contribute to the incidence of this cancer. However, the other two BRCA1-5382insC and BRCA2-6174delT mutations showed higher frequencies (2 to 3 times) in patients with CaP than in those with the BPH lesion, with respectively 62.7% versus 37.3% and 65.1% versus 34.9%. For individuals with adenocarcinoma of the prostate, most cases had a Gleason score greater than or equal to 7 (87%); with 13% of individuals having a Gleason score equal to 6. Gleason scores for prostate tumours were classified into subgroups <7 and ≥7. This threshold was chosen based on clinical experience and previous literature suggesting that the clinical outcome for prostate cancer of Gleason score 7 is more similar to that of Gleason score 8 to 10 than for Gleason score <7 disease2 [20]. Table 3 shows the association between Gleason scores and BRCA1/BRCA2 mutations. Individuals with cape with BRCA1/2 germline mutations were more frequently associated with Gleason score ≥ 8, at stage T3/T4. BRCA1-5382insC and BRCA2-6174delT mutation carriers conferred a 2 to 3-fold increased risk of high-grade prostate cancer. Although the BRCA1-185delAG mutation has not been associated with prostate cancer, it may be associated with high Gleason score tumours. These results must be carefully taken into account in genetic counselling.

Table 3: Association between Gleason scores and BRCA1 /BRCA2 mutations

Gleason score/BRCA mutations

BRCA1-185delAG BRCA1-5382insC BRCA2-6174delT
N individuals N individuals

N individuals

Gleason score 6

0

5 4

Gleason score 7

4 12

9

Gleason score 8

6

13 11

Gleason score 9

0 2

2

Discussion

When analysing the genetics of CaP, it is essential to distinguish between localised, high-risk and metastatic disease. Firstly, due to the widespread adoption of PSA, the majority of new CaP diagnoses are low-grade localised disease with an excellent prognosis. These diagnoses are clinically distinct from the comparatively fewer diagnoses of advanced metastatic CaP [21] which are known to have the potential for a poor outcome. Several studies have shown that the genomic/genetic landscape of metastatic castration-resistant CaP (mCRPC) is different from that of localised [22,23]. It is difficult to obtain meaningful clinical predictions by examining CaP as a whole, given the great clinicopathological heterogeneity of the disease. This can be illustrated by germline mutations in BRCA2 which have been underestimated as a driver of hereditary prostate cancers. Genomic profiling of CaP was initially extrapolated from material acquired during unselected prostatectomies and genetic abnormalities were therefore considered rare [24]. As a result, verification bias prevented reporting the true prevalence of pathogenic genetic mutations in advanced metastatic cape. This work was designed to assess the impact of BRCA 1 and BRCA 2 mutations in prostate cancer in the Thiès region with the association of the three founder mutations BRCA1-185delAG and BRCA1-5382insC and BRCA2-6174delT. This study revealed that the highest frequency of BRCA1 mutations in CaP patients was BRCA1-5382insC (62%) followed by BRCA1 185-delAG (40%). The frequency of BRCA1 mutations in patients with a BPH lesion was 60% for BRCA1-185delAG and 38% for BRCA1-5382insC. In addition, the global BRCA2-6174delT mutation was identified in 65.1% of patients with cape versus 34.9% of those with a BPH lesion. These results suggest that the BRCA2-6174delT and BRCA1-5382insC mutations are likely to contribute to the incidence of prostate cancer in the Thiès region, which is not the case for the BRCA185-delAG mutation, which shows no significant difference in patients with CaP. Our results are comparable to those of Gallagher et al. in 2010 [24] and Agalliu et al. in 2009 [25] where they found mutation frequencies for the BRCA1-5382insC and BRCA2-6174delT genes to be largely predominant in individuals with CaP. Studies of breast cancer by Abou El Naga et al. reported contradictory results, with the two mutations (BRCA1-5382insC and BRCA2-6174delT) showing higher frequencies in healthy controls than in breast cancer patients [26]. In addition, we found that the risk of prostate cancer associated with carrying these mutations was higher in men diagnosed at an older age (65 or over) and in particular in those with the BRCA2-6174delT and BRCA1-5382insC mutations.

A number of previous studies have examined the associations between these BRCA1/BRCA2 mutations and prostate cancer [17,28-30]. Struewing et al. [27] estimated a lifetime risk of CaP of 16% for BRCA1/BRCA2 mutation carriers and 3.8% for non-carriers. Our results reported that BRCA2-6174delT and BRCA1-5382insC mutation carriers had two to three times the risk of prostate cancer, and as indicated here, the BRCA1-185delAG mutation was not associated with prostate cancer. Our results contradict those of Giusti et al. [30] who found the BRCA1-5382insC mutation not to be associated with prostate cancer. The absence of a detectable effect for the BRCA1-185delAG mutation could be linked to its low prevalence in the population, or to the effects of allelic heterogeneity. In support of a role for prostate cancer-associated BRCA2 mutations, studies of breast and/or ovarian cancer families harbouring disease-associated BRCA2 mutations have reported that male family members carrying such mutations have an increased risk of prostate cancer [31-33]. A Finnish study [34] of breast and/or ovarian cancer families also reported a 5-fold increase in the risk of prostate cancer in men carrying BRCA2 protein-truncating mutations. First-degree male relatives of breast cancer patients with protein-truncating BRCA2 mutations had a 4.8% risk of prostate cancer [35]. In 2012, studies by Castro et al. [36] reported that BRCA2 mutation status was found to be an independent predictor of median cause-specific survival. Interestingly, the non-carrier group also had a poorer outcome than other sporadic CaP series, suggesting that a family history of breast cancer could somehow affect the prognosis of prostate cancer patients.

In the present study, a major proportion of mutation carriers had a Gleason score ≥ 7 (87%); our results are similar to those of Gallagher et al. in 2010 [24] where 85% of mutation carriers had Gleason disease ≥7. Our results were striking, with 22 of 26 (84.6%) BRCA2-6174delT mutation carriers and 27 of 32 BRCA1-5382insC mutation carriers (84.3%) showing Gleason disease ≥7, representing a group with an aggressive phenotype and confirming this association reported by Agalliu et al. [25]. However, individuals carrying these two mutations may be associated with a higher risk of prostate cancer and are also likely to have poor survival as reported by Edwards et al. in 2010 [37]. This is also reflected in the study by Kote-Jarai et al. where the proportion of high grade CaP (Gleason score ≥ 8) was 63% significantly elevated [14].The study by Gallagher et al. reported that BRCA2 mutation carriers had an increased risk of CAP and a higher histological grade and that BRCA1 or BRCA2 mutations were associated with a more aggressive clinical course [24] results confirmed by studies by Castro et al. in 2013 in a large retrospective cohort [38].

Conclusion

Prostate cancer is the second most common cancer in men worldwide and is a complex heterogeneous disease with high heritability. Our results showed that BRCA2-6174delT and BRCA1-5382insC mutations are strongly associated with a very aggressive form of prostate cancer. Molecular characterisation of CaP patients should be systematically integrated into healthcare structures in order to select patients who are more likely to respond to targeted agents. In addition, in the event of a family history of hereditary breast cancer (± hereditary ovarian cancer), it is recommended that the patient be referred to an oncogenetic consultation to look for a mutation in the BRCA1 and BRCA2 genes. In the case of aggressive prostate cancer (high Gleason score or locally advanced or metastatic stage) in a patient under the age of 50, it is recommended that the patient be referred to an oncogenetic consultation to look for a mutation in the BRCA2 and HOXB13 genes (level of evidence 2a) [39]. Further clinical trials would be needed to assess the impact of genomic nuances in reducing the morbidity and mortality prevalent with prostate cancer.

Acknowledgement

The authors are very grateful to the patients who participated in this study. We are extremely grateful to Dr Modou Faye who helped for sample collection. Also Pr SEMBENE, head of the genomics laboratory for all the molecular studies carried out and Pr Tonleu Linda Bentefouet, head of the cytological and pathological anatomy unit for the histopathological diagnoses.

Conflict of Interest

The authors have declared no conflicts of interest.

References

  1. Sung H Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. (2021) Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71: 209-249. [crossref]
  2. Santé OMdl Cancer. 2022. Available from: https: //www.who.int/fr/news-room/fact-sheets/detail/cancer.
  3. Hjelmborg JB, Scheike T, Holst K, Skytthe A, Penney KL, et al. (2014) The Heritability of Prostate Cancer in the Nordic Twin Study of Cancer. Cancer Epidemiol. Biomark Prev 3: 2303-2310. [crossref]
  4. Ferlay J, Ervik M, Lam F (2018) Global Cancer Observatory: Cancer Today; International Agency for Research on Cancer: Lyon, France.
  5. Termini D, Hartogh DJD, Jaglanian A, Tsiani E (2020) Curcumin against Prostate Cancer: Current Evidence. Biomolecules 10. [crossref]
  6. Wen S, Chang HC, Tian J, Shang Z, et al. (2015) Stromal Androgen Receptor Roles in the Development of Normal Prostate, Benign Prostate Hyperplasia, and Prostate Cancer. Am J Pathol 185: 293-301. [crossref]
  7. Cittadini A, Isidori AM, Salzano A (2021) Testosterone therapy and cardiovascular diseases. Cardiovasc Res 118: 2039-2057. [crossref]
  8. Rawla P (2019) Epidemiology of Prostate Cancer. World J Oncol 10: 63-89. [crossref]
  9. Parkin DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA Cancer J Clin 55: 74-108. [crossref]
  10. Bluemn EG, Nelson PS (2012) The androgen/androgen receptor axis in prostate cancer. Curr Opin Oncol 24: 251-257. [crossref]
  11. Ziaran S, Novakova ZV, Böhmer D, DanišoviˇcL (2015) Biomarkers for determination prostate cancer: Implication for diagnosis and prognosis. Neoplasma 62: 683-691. [crossref]
  12. Patel AR, Klein EA (2009) Risk factors for prostate cancer. Nat Clin Pract Urol 6: 87-95.
  13. Messina C, Cattrini C, Soldato D, Vallome G, Caffo O, et al. (2020) BRCA Mutations in Prostate Cancer: Prognostic and Predictive Implications. J Oncol 2020: 4986365. [crossref]
  14. Kote-Jarai Z, Leongamornlert D, Saunders E, Tymrakiewicz M, Castro E, et al. (2011) BRCA2 is a moderate penetrance gene contributing to young-onset prostate cancer: Implications for genetic testing in prostate cancer patients. Br J Cancer 105: 1230-1234. [crossref]
  15. Ewald IP, Izetti P, Vargas FR, Moreira MA, Moreira AS, et al. (2011) Prevalence of the BRCA1 founder mutation c.5266dupin Brazilian individuals at-risk for the hereditary breast and ovarian cancer syndrome. Hered. Cancer Clin Pract 9.
  16. Abeliovich D, Kaduri L, Lerer I, Weinberg N, Amir G, et al. (1997) The founder mutations 185delAG and 5382insC in BRCA1 and 6174delT in BRCA2 appear in 60% of ovarian cancer and 30% of earlyonset breast cancer patients among Ashkenazi women. Am J Hum Genet 60: 505-514. [crossref]
  17. Ford D, Easton DF, Stratton M, Narod S, Goldgar D, et al. (1998) Mar. Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. The breast cancer linkage consortium. Am J Hum Genet 62: 676-689. [crossref]
  18. Neuhausen SL, Ozcelik H, Southey MC, John EM, Godwin AK, et al. (2009) Breast Cancer Family Registry. BRCA1 and BRCA2 mutation carriers in the Breast Cancer Family Registry: an open resource for collaborative research. Breast Cancer Res Treat 116: 379-386. [crossref]
  19. Hartwig M, Janiszewska H, Bąk A, Pilarska M, Heise M, et al. (2013) Prevalence of the BRCA168_69delAG (BIC: 185delAG) mutation in women with breast cancer from north-central Poland and a review of the literature on other regions of the country. Contemp Oncol (Pozn) 17: 34-37.
  20. Thompson KE, Hernandez J, Canby-Hagino ED, Troyer D, Thompson IM (2005) Prognostic features in men who died of prostate cancer. J Urol 174: 553-556; discussion 56. [crossref]
  21. NCCN Clinical Practice Guidelines in Oncology. Prostate Cancer Version 2.2031; National Comprehensive Cancer Network: Plymouth Meeting, PA, USA, 2021.
  22. Robinson D, Van Allen EM, Wu YM, Schultz N, Lonigro RJ, et al. (2015) Integrative clinical genomics of advanced prostate cancer. Cell 161: 1215-1228. [Crossref]
  23. Network CGAR (2015) The Molecular Taxonomy of Primary Prostate Cancer. Cell 163: 1011-1025. [crossref]
  24. Gallagher DJ, Gaudet MM, Pal P, Kirchhoff T, Balistreri L, et al. (2010) Germline BRCA mutations denote a clinicopathologic subset of prostate cancer. Clin Cancer Res 16: 2115-2121. [crossref]
  25. IlirAgalliu, Robert Gern, Suzanne Leanza, Robert DB (2009) Associations of High-Grade Prostate Cancer with BRCA1 and BRCA2 Clin Cancer Res15 February 1, 2009.
  26. Amoura Abou-El-Naga, Ahmed Shaban, Hayam Ghazy, Afaf Elsaid, Rami Elshazli, Ahmad Settin (2018): Frequency of BRCA1 (185delAG and 5382insC) and BRCA2 (6174delT) mutations in Egyptian women with breast cancer compared to healthy controls, Meta Gene 15: 35-41.
  27. Struewing JP, Hartge P,Wacholder S, et al. (1997) The risk of cancer associated with specific mutations of BRCA1 and BRCA2 among Ashkenazi Jews. NEngl J Med 336: 1401-1408. [crossref]
  28. Kirchhoff T, Kauff ND, Mitra N, et al. (2004) BRCA mutations and risk of prostate cancer in Ashkenazi Jews. Clin Cancer Res ;10: 2918-21. [crossref]
  29. Vazina A, BanielJ, ShtrikerA, et al. (1999) The prevalence of the major Jewish mutations BRCA1 and BRCA2 in prostate cancer patients in Israel. J Urol 161: 55-56. [crossref]
  30. Giusti RM, Rutter JL, Duray PH, et al. (2003) A twofold Iicrease in Brca mutation related prostate cancer among Ashkenazi Israelisisn ot associated with distinctive histopathology. J Med Genet 40: 787-792. [crossref]
  31. The Breast Cancer Linkage Consortium. Cancer risks in BRCA2 mutation carriers (1999). J Natl Cancer Inst 91: 1310-1316.
  32. Van Asperen CJ, Brohet RM, Meijers-Heijboer EJ, Hoogerbrugge N,Verhoef S (2005) Cancer risks in BRCA2 families: estimates for sites other than breast and ovary. JMed Genet 42: 711-719. [crossref]
  33. Thompson D, Easton DF (2002) Breast Cancer Linkage Consortium. Cancer incidence in BRCA1mutation carriers. JNatl Cancer Inst 94: 1358-1365. [crossref]
  34. Eerola H, Pukkala E, Pyrhonen S, et al. (2001) Risk of cancer in BRCA1 and BRCA2 mutation positive and-negative breast cancer families (Finland). Cancer Causes Control 12: 739-746. [crossref]
  35. Tulinius H, Olafsdottir GH, Sigvaldason H, et al. (2002) The effect of a single BRCA2 mutation on cancer in Iceland. JMed Genet 39: 457-462. [crossref]
  36. Elena Castro, Rosalind Eeles (2012) The role of BRCA1 and BRCA2 in prostate cancer. Asian Journal of Andrology 14: 409-414. [crossref]
  37. Edwards SM, Evans DG, Hope Q, Norman AR, Barbachano Y, et al. (2010) Prostate cancer in BRCA2 germline mutation carriers is associated with poorer prognosis. Br J Cancer 103: 918-924. [crossref]
  38. Elena Castro, Chee Goh, David Olmos, Ed Saunders, Daniel Leongamornlert, et al. (2013) Germline BRCA Mutations Are Associated With Higher Risk of Nodal Involvement, Distant Metastasis, and Poor Survival Outcomes in Prostate Cancer. J Clin Oncol 31: 1748-1757. © by American Society of Clinical Oncology.
  39. Rozeta F, Hennequin C, Beauval JB, Beuzeboc P, Cormier L, et al. (2018-2020) Recommandations françaises du comité de cancérologie de l’AFU-Actualisation.

Function Inspired Structures of Proto-Ribosome and the First Aminoacyl-tRNA Synthetase: Origin of life in the water of the Earth (III)

DOI: 10.31038/GEMS.2023581

Abstract

The first protein must produce at random processes. However, it is difficult to replicate correct protein without any control. The activities of control must be different from activities to be control. It is known that organisms replicate proteins via ribosomes by using genetic information. The mechanism that had replicated proteins naturally is a bridge between living organism and nonliving organism. We can make assumptions about structure of proto-ribosome on the base of its functions. That is, a proto-ribosome would have sandwiched L-type mRNA and D-type tRNA in part of a phospholipid bilayer. This structure can be used to estimate the initial processes of replicated proteins and the initial formation of aminoacyl-tRNA synthetases.

Keywords

Enzyme world, Ribosome, DNA, mRNA, tRNA, Aminoacyl-tRNA synthetase

Introduction

The first life had formed in non-extreme environment on the Earth because the first cell with gene system must have naturally formed. However, many of traditional studies of the origin life have been carried out on extremophiles [1], because most of professional researchers must acquire budgets, they have been studied by the acquired budget. The organisms had been born, then evolved by adaptations in its environment. By the results of evolution, extremophiles can live only in extreme environment [2]. On the other hand, there are numerous descriptions on molecular biology [3]. Especially ongoing progress in the structural biology is giving a physico-chemical basis that explains facets about tRNA [4]. Replication of protein is controlled via the informational media of double helix of DNA discovered by Watson and Click [5]. Karasawa reported that the replication processes of DNA are possible to reveal based on the structure of DNA [6,7]. The initial process of protein replication can be revealed based on the structure of the proto-ribosome which includes mRNA and tRNA in a part of a phospholipid bilayer. Here, the mRNA is left-handed (L-type) chirality, while the tRNA is right-handed (D-type). Although these two strands with different chirality enter a plathome of processing of central part of the double-layer, those strands never coalesce. The double-layered helical structures are indispensable in the ribosome-translation machinery.

Preparations

Formation of mRNA, tRNA and DNA

Organic molecules such as hydrocarbons were accumulated on the surface of water, and macroscopic boundary conditions formed a membrane [6]. When amino acid molecules adhered to the membrane, those molecules were formed molecular structures possessing with the function of enzymes. The first organization of life had formed in the world of enzymes. Current protein is replicated in a ribosome via short-lived mRNA and tRNA. Those mRNA and tRNA are produced from a replicated DNA [7]. Since RNA is a tool to deal with genetic information, the first life should be discussed in the real world of enzymes instead of the informational world of RNA.

Matching Processes between mRNA and tRNA

When amino acids adhere a membrane, conformation of a part of membrane is modified. The changed conformation of the membrane includes information on the amino acid sequence of a protein. Even though a proto-DNA is formed by simplifications from the membrane by exclusion of the protein, it possesses information of size and segmentation on the amino acid. Such information is used for the first matching processes between template of mRNA and matching objects of tRNA. Subsequent evolutions, pairing relationships for the matching was established by complementary base pairs of codons and anticodons. So, intermittently fixing of a segment of mRNA for a specified amino acid in a protein, each tRNA is shifted along the mRNA in order to looking for the partner of hydrogen bonds.

Leading Strand and Lagging Strand of DNA

Since chirality of mRNA is L-type but tRNA is D-type, two kinds of RNA do not merge. It is known that the chirality of biomolecule in the Earth, amino acids are L-type, and sugars are D-type. So, the membrane adhered with protein and bases has L-type chirality, but D-type of helical structure will be formed due to antagonistic and organized movements of interconnected helix structures [7]. That is, alternate rotations around X axis through the center of tetrahedron units changes the shape of tetrahedral unit projected in the X-Y plane from square to trapezoidal. When a pair of atoms of tetrahedron located at the end of the long and short site vibrate up-and-down movements, inner and outer in the tetrahedron’s vertices vibrate opposite directions. Under an assumption of such antagonistic movements, leading strand and lagging strand of DNA are synthesized simultaneously at each segmentation of the amino acid. Since each amino acid has individual size, the segment of constituent of ribosome for an amino acid is the same. tRNA is formed by a single D-type of lagging strand with base due to chirality difference between amino acid and lagging strand. So, the leading strand replicates continuously, whereas the lagging strand replicates discontinuously forming short fragments. Since bases of two RNAs touch via hydrogen bonds, tRNA is possible to move independently from mRNA. Here, the complementary anticodon of tRNA is vertical flip symmetry of corresponding amino acid of mRNA.

Results

Formation of Proto-ribosome in a Phospholipid Bilayer

Phospholipid contains a chiral center at C2 position of a glyceryl moiety [7]. Twisted phospholipids laterally interlock, and the interlock induces systematic motions due to systematic thermal vibrations of atoms [8]. A double layer sandwiched between two layers of hydrophilic heads spontaneously forms. If one of the layers in part of the bilayer is rotated by 180°, the progress of the helix is changed from the output side to the input side at the center of the bilayer. This bilayer, despite having two chirality centers, provides a one-directional screw movement by the one-directional rotation. When only mRNA enters the bilayer, it passes through the bilayer. However, if tRNA enters from the other side of the mRNA, both strands come into conflict at the central portion owing to chirality [7]. mRNA and the series of tRNA’s are sandwiched between a protein and a series of amino acids with base pairs facing each other at the center. Figure 1 is an illustration of a structure of proto-ribosome and its constituents proposed in this paper.

FIG 1

Figure 1: A structure of proto-ribosome and with its constituents

Prospect of the Protein Replication: Evolutions of Gene System on Chain Reactions

When a biological reaction is performed, a new reaction occurs due to change of the situation caused by the reaction. A chain reaction will continue to circulate if it forms a loop. A relationship of “from demand to the supply” will be included in those chain reactions. In various chain reactions, protein molecules that express repeated chain reactions will be formed and the enzymes will be formed. The chain reactions those support the survival of life will be incorporated into genes system in the form of long DNA. Then, Prokaryote have evolved to Eukaryote by formation of a nucleus of the cell in order to memorize very long DNA.

Discussions

Molecular Mechanisms Underlying Ribosome Dynamics

A step of protein replication is proceeded by amino acid unit at platform of a ribosome. The triplet base pairs in a DNA for each amino acid are formed via pattern matching on hydrogen bond between codon of mRNA and anticodon of tRNA. The complementally base pairs are adenine with thymine (A-T) and cytosine with guanine (C-G) for each base step. Incidentally, an aminoacyl-tRNA synthetase makes linkage between the triplet code and an amino acid by the direct attachment of an amino acid and corresponding tRNA [9]. Tamura, Schimmel reported about non-enzymatic aminoacylation of an RNA minihelix [10]. Karasawa proposes a functional model of aminoacyl-tRNA synthetase that comes from a cover around the functional model of aminoacyl-tRNA as shown in Figure 1. The linkage between amino acid and the triplet is carried out by an aminoacyl-tRNA synthetase. The proto-DNA forms a unique conformation when interacting with amino acids. The proto-DNA must possess information on amino acid. The enzyme binds with specific molecules, resulting in a conformational change, and carries out function of the catalyst. However, even the base sequence of tRNA has been revealed, understanding the molecular mechanisms underlying tRNA dynamics is yet challenging [11].

Conclusions

The author proposes that the first life should be discussed in the real world of enzymes instead of the informational world of RNA. Over the course of evolution, if a new mechanism is added alongside conventional mechanisms that functioning during life activities, the new mechanism must coexist with the conventional system. Eventually, the new system that successes to survive will remain, and unnecessary system will disappear. The research based on the current system is difficult to reveal the disappeared structures. The proto-ribosome was estimated based on the necessity that shifts tRNA reversely for mRNA and confirms the matched amino acid sequences. We can describe fundamental functions of ribosome by assuming such simple initial structure and its environments. The bottom-up approaches based on acceptable assumptions are useful to reveal initial processes of protein replications. However, there is a gap between the proposed model and current nucleotide sequence models in the molecular biology. It is known that the evolution of living organisms has influenced the Earth’s atmosphere and geology. It is another desire of the author that the proposed functional models will become bridges between living organisms and the field of geology of the Earth.

References

  1. Merino N, Heidi SA, Diana PB, Jayme FB, Michael LW, et al. (2019) Living at the Extremes: Extremophiles and the Limits of Life in a Planetary Context, Front Microbiol. [crossref]
  2. von Hegner I (2021) Extreme exoworlds and the extremophile paradox, arXiv.org | Cornell University Library, September.
  3. Watson JD, et al. (2004) Molecular biology of the Gene, 5th Ed. Benjamin Cummings.
  4. Nakanishi K, Nureki O (2005) Recent progress of structural biology of tRNA processing and modification. Mol Cells 19: 157-166. [crossref]
  5. Watson JD, Click FH (1953) Genetical Implications of the Structure of Deoxyribonucleic Acid, Nature 171: 964-967.
  6. Karasawa S (2023) Origin of life in the water of the Earth. Geology, Earth and Marine Science 5: 1-7.
  7. Karasawa S (2023) Initial processes on replication of DNA by interactions of helical structured molecules-Origin of life in the water of the Earth (Ⅱ). Geology, Earth and Marine Sciences 5: 1-7.
  8. MacKenzie LE, Stachelek P (2021) The twists and turns of chiral chemistry. Nature Chemistry 13: 521-522.
  9. Ibba M, Soll D (2000) Aminoacyl-tRNA synthesis. Annual Review of Biochemistry 69: 617-650.
  10. Tamura K, Schimmel P (2004) Non-enzymatic aminoacylation of an RNA minihelix with an aminoacyl phosphate oligonucleotide. Nucleic Acids Symposium Series 48: 269-270.
  11. Giege R, Frank J, Joern P, Peter S, Claude S, et al. (2012) Structure of transfer RNAs: Similarity and variability. WIREs RNA 3: 37-61. [crossref]

Predictors of Listening and Reading Comprehension in Arabic as the First Language and Listening and Comprehension in English as a Foreign Language: Two Different Orthographies

DOI: 10.31038/ASMHS.2023722

Abstract

Both listening and reading comprehension have not been sufficiently studied in the context of Arabic and English language orthographies. The main goal of the current research was to investigate how listening and reading comprehension among native Arabic speakers predict the use of Arabic and English language orthographies in learning English as a foreign language (FL) in Israel. The Arab minority in Israel learn three languages: Arabic as their first language (L1), Hebrew as the language of the state of Israel (L2), and English as a foreign language (FL). Consequently, the dissimilarity between Arabic and English orthographies poses several challenges in learning English as a foreign language among Israeli Arab students. Arabic and English are alphabetical writing systems but represent different orthographies. A total of 100 Arabic-speaking high school students were asked to administer a set of phonological, linguistic, and cognitive scales. The results of the present study indicated that predictors of listening and reading comprehension in Arabic and predictors of listening and comprehension in English are different. Another finding of the present study was that predictors in Arabic language predict listening and reading comprehension in English. However, the Arabic skills predictors for listening comprehension are different than the Arabic skills predictors for reading comprehension. The results are discussed in light of previous findings in the literature as well as in relation to the different orthographies of Arabic and English languages.

Keywords

Reading comprehension, Listening comprehension, Two different orthographies, First and foreign languages

Introduction

The present research examines the Arabic and English language orthographies and their effect on listening and reading comprehension among Arab learners of English as a foreign language in Israel. Arabic and English are alphabetical language systems but differ in many aspects. This research aims to focus on the difference between Arabic and English orthographies, which lies within the relationship between the sound and letters also known as orthographic depth. Therefore, this research aims to clarify how listening and reading comprehension among Arabic speakers predict the use of these two abilities in English as a foreign language. The novel aspect of this research is examining listening and reading comprehension among Arabic learners of English in relation to their different orthographies in one study. It is expected that the characteristics of English and Arabic orthographies may not affect linguistic skills, as learners with different orthographic backgrounds adapt distinct linguistic skills to learn the language. Additionally, the learners’ performance in listening and reading comprehension may be lower in English compared to Arabic, considering the distinct characteristics of Arabic and English orthographies.

By studying Arabic and English language orthographies among Arabic learners in Israel, we can better understand the process of how learners with different orthographic backgrounds learn a language. In this paper, the uniqueness of the Arabic and the English language orthographies and their features and role in listening and reading comprehension will be discussed in depth. Subsequently, the research methodology and procedure will be presented. Finally, the findings will be analyzed followed by the discussion, conclusions, and limitations of the study.

Literature Review

Few studies have investigated the role of listening and reading comprehension in the first language as a predictor of linguistic skills in another language [1,2]. Listening comprehension and reading comprehension are similar skills but constitute two distinct forms of comprehension involving different cognitive processes [3-7]. Listening comprehension depends on an understanding of a spoken language while reading comprehension depends on an understanding of a written language [8]. While reading comprehension depends on decoding skills, which are predicted by phonological awareness, listening comprehension depends on word processing and is predicted by vocabulary knowledge [9]. Aspects of language processing and skills, namely Arabic orthography, English orthography, reading comprehension, listening comprehension, transfer of skills, phonological decoding skills, spelling, morphology and vocabulary, syntax, speed of processing, orthographic knowledge, working memory, attitudes and language, will be deeply explored in order to investigate predictors of listening and reading comprehension in both Arabic and English, two different orthographies.

Arabic Orthography

The Arabic language is a Semitic language, and it has 28 letters, including six vowels: three short vowels and three long vowels [10]. The short vowels are presented by diacritic marks above or beneath the letter [11], while long vowels are represented by the following letters: “alef,” “ya,” and “waw” [12]. Short vowels in Arabic add phonological information for word decoding and thus contribute to understanding texts [13,14]. In other words, the short vowels contribute to the correct pronunciation of Arabic sounds and letters [15]. This language is read and written from right to left and is regarded as shallow orthography that exhibits a predictable relationship between letters and sounds [16]. As a result, the development of literacy skills such as reading and spelling are learned quicker than in inconsistent orthographies [17]. In addition, the Arabic language is regarded as deep orthography when unvowelized [14,18,19]. In Arabic, short vowelization contributes to reading comprehension of less complex texts, such as informative and narrative texts and newspaper articles among readers of different ages and levels [20,21] reviewed the role of vowelization in Arabic and showed that short vowelization improves reading accuracy and reading comprehension. Other studies by [13,16,22,23] proved that Arabic orthography poses an intensive visual burden and slows down reading and can be considered as deep orthography. Therefore, reading in Arabic depends on the visual orthographic representation of a word. Furthermore, Arab readers after the fourth grade are expected to learn and read unvowelized texts in which they tend to rely on sentence context [13].

It is interesting to note the phenomenon of diglossia in the Arabic language, which refers to the use of two versions: spoken Arabic and literary Arabic [13,24,25]. Spoken Arabic has various dialects, and native Arabic speakers use spoken Arabic in everyday life, but literary Arabic is used in education, writing, the Qur’an, and literature [13,22,25,26]. Spoken and literary Arabic vary considerably in terms of phonology, vocabulary, syntax, and grammar and thus affect language development and reading acquisition [11,14,15,29]. This phenomenon also affects reading and writing in Arabic as it has negative effects on phonological awareness that is associated with reading and spelling acquisition [26].

English Orthography

The English language has 26 letters, including 5 vowels and 21 consonants, and it is read and written from left to right [10]. The vowels in English are letters within the words and represent the sounds [28]. Some letters are written in a word but not pronounced as they are spelled, which is more common in English than in Arabic [26,29]. English is also an alphabetical system characterized by an indirect relationship between a letter and its sound [16]. Therefore, English is regarded as deep orthography, in which the same letter may have various sounds written differently [10,30]. For example, the grapheme-phoneme “gh” is pronounced differently in the following words “ghost,” “light,” and “tough.” As a result, the rate of reading development in English is low among children in comparison with more consistent orthographies [30,31].

Second and foreign language learners tend to use L1 linguistic skills and learning strategies to learn another language according to the language linguistic skills transfer [28,32]. Although English and Arabic are alphabetical systems, the degree of dissimilarity of their orthographic representation affects learning English as a foreign language by Arabic-speaking learners [14]. According to the orthographic depth hypothesis, in deep language orthography, semantic context (lexical) is used for word recognition, while shallow language orthography relies on the phonology for decoding words [11,10]. In the case of the Arabic language, which is a shallow orthography, Arabic-speaking learners of English rely on consonants in word decoding for word recognition [33]. However, in the English language, the corresponding spelling-to-sound is inconsistent, and thus learners must rely more on activating both phonological and orthographic processes in learning and reading [34]. A more recent study by [8] shows that in deep orthographies, word recognition is the main predictor of reading comprehension, especially in an early stage of reading development, while in shallow orthographies listening comprehension is more significant in reading comprehension in different phases of reading development.

Reading Comprehension

Scholars have widely investigated reading comprehension in first and second languages [8,15,11,35,36]. Numerous studies explored reading comprehension and demonstrated that it is a determinant of reading accuracy [8,10]. Reading comprehension of written texts is the outcome of decoding and listening comprehension [1,14,36,37]. It also refers to the ability to extract meaning from written representations of the language in order to construct new meanings by activating previous knowledge [15,25]. The two foundational skills of reading comprehension are word recognition, which refers to the ability to read individual words accurately, and listening comprehension [8]. In a more recent study, word recognition highly contributes to reading comprehension among beginner readers, and listening comprehension appears strongly to correlates with advanced readers [36]. Previous studies also found that vocabulary contributes to reading comprehension [35,37].

It is important to note that these skills of reading comprehension may function differently according to the orthographic features of the language. In shallow orthographies, learners depend more on phonology and the high consistency of the sound and letters in word recognition and word learning [11,38]. In contrast, in deep orthographies, learners must learn the complexity of the low consistency of the sound and letters in word recognition [11,38]. In addition, word recognition appears to be a predictor of reading comprehension in deep orthographies while listening comprehension appears to be a determinant predictor of reading comprehension in shallow orthographies [8]. In deep alphabetic orthographies, learners depend on increased word processing skills, such as phonetic awareness, letter-to-sound relationship, and visual representation of the word in ESL reading comprehension compared to less deep alphabetic orthographies [38].

Listening Comprehension

Listening comprehension is critical for language acquisition and reading comprehension and also has a significant role in the communication and language learning process [18,34,39]. However, unlike reading comprehension, listening comprehension has failed to attract the attention of language researchers [7,34], despite the rise of audio-visual platforms, such as TV and computers among children and adolescents. Listening comprehension refers to the ability to construct the meaning of spoken language and relate it to previous knowledge [8]. The literature review shows that the process of listening comprehension involves several key components, including word recognition, syntax, vocabulary, speed of talk, and previous knowledge that impact listening comprehension [18]. Unlike reading comprehension, the process of listening comprehension poses a major challenge for learners, as it requires rapid processing of meaning and linguistic skills, including syntax and lexical, due to the transient and temporary nature of the spoken text [36,40]. The contribution of listening comprehension to reading comprehension increases with age while decoding decreases as readers become increasingly proficient in decoding as they get older [14,34,35]. Vocabulary is the most important component of listening comprehension [7,35].

Little research has been done on listening comprehension in L1 and its role in predicting later language skills in a second language [34,36]. [39] has suggested that pre-listening activities and repetitive listening to a passage enhance listening comprehension and contribute to language proficiency among learners of Arabic as a foreign language. Because Arabic is a diglossic language, listening comprehension is reportedly affected by the spoken language as it relies on oral language [14]. Additionally, short vowels in Arabic contribute to listening comprehension across all grade levels [18]. However, the role of spoken language and listening comprehension across a variety of languages is still unclear [8].

A closer look at the literature on listening comprehension and reading comprehension, however, reveals a number of gaps and shortcomings. Therefore, this research addresses the need for an in-depth examination of the predictors of listening and reading comprehension in different orthographies among Arabic-speaking learners of English as a FL.

Transfer of Skills

Cummins’ (1991) linguistic interdependence hypothesis suggests a relationship between the first language and the learning of the second language. This relationship is indicated in the transfer of language skills, including phonological awareness, word recognition, reading comprehension, and other linguistic skills between languages [31]. This hypothesis depends on language-independent skills, such as phonology, morphology, and syntax that transfer across languages [11,34]. Studies on the role of listening comprehension and the transfer of this skill from L1 to reading comprehension in L2 are rare however [34]. Most studies have focused on language linguistics skills transfer, including reading, spelling, and phonological awareness and have neglected oral language skills transfer [2,16,34,41]. The transfer of skills across languages, either first to second\foreign language or in the opposite direction has been widely investigated by researchers [11,16,27]. In a study that investigated the transferability of phonological awareness in opposite direction, from L2 to L1, it was found that improvement in linguistic and meta-linguistic skills in a second language positively influenced similar skills in L1 [41]. It is interesting to relate that the transfer of linguistic and language skills is affected by the degree of similarity between the two languages [11,34,38]. As a result, a high degree of similarity between L1 and L2 enables the transfer of language skills, while distinct orthographic backgrounds of L1 and L2 affect decoding efficiency and word learning [42]. Despite decades of research, this issue continues to be debated regarding the transfer of linguistic skills across different languages [11,15,27,28,41].

Phonological Decoding Skills

Phonological awareness is one of the most researched basic meta-cognitive linguistic skills in language learning, and it refers to the awareness of the sound structures of language units [24,41]. Most studies, early as well as current, have demonstrated the importance of phonological awareness in predicting high performance in the reading process across languages [11,15,24]. A study of reading-disabled Arabic-English bilingual Canadian children showed that they scored higher scores in phonological tests than monolingual English-speaking children, despite the different nature of the two orthographies [28]. However, some studies have assumed that the degree of similarity of orthographic systems between L1 and L2 influence the learners’ performance in phonological decoding and word learning in L2 [42]. In another study, it was noted that differences in the orthographic background between L1 and L2 might affect phonological processing and word decoding in L2 [2]. In a recent study, an intervention program in English for improving linguistic and meta-linguistic skills in Hebrew as L1 and English as FL indicated a significant improvement in most skills, including phonological awareness from pre-intervention to post-intervention among three groups of readers: dyslexic, poor, and normal readers [10]. In short, phonological awareness is a cross-language skill; with increased exposure and practice of the target language, learners may be able to become more skilled in phonological skills [2,11].

Spelling

Spelling skills refer to the visual representation of a spoken language and depend on other language skills, such as phonology, orthography, and morphology of the target language [38,43]. Spelling involves two significant processes: phonological awareness and alphabetic knowledge that influence the ability in learning to read, write, and spell [2,44]. In a study by [33], Japanese poor readers revealed high performances in recognition tasks compared to Russian readers, due to their L1 experience with kanji (logographic Japanese writing system). Likewise, [28] proved that spelling is a cross-language correlated skill among Arabic-English disabled bilingual readers. The varying degree of orthography between languages affects the development of reading and spelling, as deep orthographies impede spelling skills compared to shallow orthographies [43]. The orthographic features of the Arabic language pose difficulties in spelling and reading among learners considering the diglossic situation and when Arabic is unvowelized [26]. More current research also has indicated that spelling needs direct instruction in the target language, supporting the fact that each language has its own orthographic rules and system [27]. Therefore, it is critical in this study to thoroughly examine spelling skills in both the Arabic and English languages.

Morphology and Vocabulary

English and Arabic have different morphological systems and features [21,22]. Arabic is a Semitic language characterized by root and pattern in which vowels determines the meaning of the word [12,16]. In contrast, English is characterized by semantic stem and morphemes (prefixes and suffixes), which allows the recognition of the meaning of the word [10]. Shallow orthographies are often complicated morphological systems while deep orthographies are less complicated [15,11]. As a result, it is assumed that it should be easier to transfer morphological skills from complex morphological systems like Arabic compared to English but the studies have proved that morphological skills are cross-language transferable [15,11]. In addition, vocabulary contributes significantly to both reading comprehension and listening comprehension [7,35]. The processing of information in listening comprehension is less focused on the vocabulary as the spoken text has a limited time frame, in contrast to reading comprehension, in which the text is permanent, allowing the reader to decode the meaning of the written text [40]. It is critical to deeply explore the role of morphology and vocabulary in predicting listening and reading comprehension both in Arabic and English and their influence among adult learners.

Syntax

Language syntax refers to the understanding of sentence structures and word order [28,35,45]. Moreover, syntax is a transferable linguistic skill across languages and contributes to improvement in both languages despite their different orthographies [11,15,41]. In a recent study, it was reported that syntax relates to reading comprehension and improvement in syntax contributes positively to reading comprehension among L2 learners of English [35]. Additional studies to better understand the role of syntax skills in language learning are needed.

Speed of Processing

The varying degree of orthography between languages affects both reading speed and comprehension [41]. In a study by [45], differences in reading were apparent among Hebrew L1 speakers when reading Hebrew and English passages. Despite Hebrew being their L1, they were more proficient in reading in English. In another study, [21,22] demonstrated that the complexity of Arabic orthography affects word identification and letter processing when compared to Hebrew. Thus, the participants demonstrated low performance in Arabic tasks in comparison to similar tasks in Hebrew. Other findings suggest that language orthography is not a direct indicator of reading comprehension levels and that reading speed is not significant in the prediction of reading comprehension. For example, a study by [6] revealed that oral comprehension is the strongest predictor of reading comprehension rather than reading speed and accuracy in Italian. Likewise, [8] suggest that listening comprehension was the best indicator of reading comprehension in comparison to oral reading fluency and word recognition in European Portuguese. Therefore, other components rather than speed seem to increase reading comprehension levels. However, the research is limited on the role of speed and its contribution to reading comprehension and listening comprehension. Thus, the speed of processing issue is still debatable and future research should be conducted.

Orthographic Knowledge

The ability to recognize written orthographic symbols of a language helps in understanding written texts or in identifying words known as orthographic knowledge [10,11,15,27]. Both Arabic and English are alphabetical orthographies, but they vary considerably in the consistency of the relationship between letters and sounds [5,29]. This variance refers to the consistency between the graphic symbol and the sound of each writing system of a language [10,29]. In other words, this variance is known as orthographic depth and has an impact on the process of reading and learning a language [5,10,11,14,30]. Orthographic depth represents the degree of sound-symbol correspondence [38]. Arabic seems to be more consistent and it is considered shallow orthography when vowelized and deep orthography when unvowelized [11,16], while English seems to be the least consistent alphabetic writing system and is considered deep orthography [16,28,30].

A large number of existing studies have examined the cross-language transfer of orthographic skills [10,11,15,16,27,28]. However, the existing research remains inconclusive on whether orthographic skills are cross-language or language-specific. Previous studies have shown that bilingual Arabic and English-speaking children performed better in pseudo-word reading and spelling tasks than monolingual English speaking children, which reflects a positive transfer from Arabic to English [28]. Recent work has proved that orthographic skills are cross-language transferable from English to Hebrew after an intervention program in English [31]. However, other studies have found that orthographic knowledge is language-specific and thus unlikely to be transferred from one language to another [16,41]. Another study also reported that orthographic knowledge is language specific and cannot be transferred from L2 to L1 among poor readers in the experiential group [11]. In addition, no significant improvement in orthographic skills both in Arabic and Hebrew was apparent after the intervention program in English L3 [15]. A more recent study confirmed that orthographic differences in languages influence the acquisition of linguistic and meta-linguistic skills, as orthographic knowledge did not show significant improvement in Hebrew following an intervention program for EFL among dyslexic, poor, and normal readers in the experimental group [10]. Therefore, it is crucial to investigate orthographic skills more extensively in order to understand their contribution and transferability across languages.

Working Memory

According to [28,45], working memory in reading refers to the capacity to retain information within the short-term memory storage while processing information. The study of bilingual Arabic-English Canadian children by [28] found that working memory is correlated across languages despite different orthographies. Furthermore, a study by [46] revealed that basic visual memory is significant in the process of reading Arabic as well as Hebrew, but not English. More recent research suggests that shallow and deep orthographies impact the performance of reading and writing as shallow orthographies are less memory dependent [43]. According to [3], short vowels in Arabic add phonology to words, which help in saving information in working memory to understand written or read aloud texts. This approach remains briefly addressed in the literature. Therefore, more research is needed on working memory skills and their contribution to learning a language in different orthographies.

Attitudes and Language Acquisition

The educational system in Israel requires the Arab minority to learn three languages in schools: Arabic as their first language, Hebrew as a second language, and English as a foreign language [16,15]. Attitudes toward language acquisition and its effect on learning Hebrew and English among the Arab minority in Israel have been widely investigated by [22,47]. Abu Rabia showed that instrumental and integrative attitudes motivate learners to learn the target language. The instrumental attitude suggests that learners learn the target language for practical reasons such as academic studies, while the integrative attitude suggests that learners identify with the target-language group and are willing to learn its language [22,47]. Many researchers claim that positive attitudes toward a language can facilitate the learning of the target language [48,49]. In addition, teachers play a significant role in developing positive attitudes toward that target language [49]. Other studies have suggested both motivation and attitude in language learning have a direct effect on learning a language [49,50]. Further research has pointed out that two types of motivation—integrative motivation and instrumental motivation—promote successful learning of the target language with emphasis on integrative motivation in maintaining long-term success [51,50]. This study is intended to examine attitudes toward learning English as a foreign language, among Arab high school students in Israel. Investigating this variable can contribute significantly to the researched topic.

Research Questions

This study has two research questions:

  1. How are listening and reading comprehension predictors in Arabic distinct from comprehension predictors in English?
  2. To what degree do language skills in Arabic predict listening and reading comprehension in English?

Both research questions are based on the literature review and the need to investigate the issue of listening and reading comprehension among native Arabic speakers in language acquisition.

Research Hypotheses

  1. Orthographic differences between Arabic and English suggest distinct predictors between listening and reading comprehension in Arabic as the first language and listening and reading comprehension in English as a foreign language.
  2. Considering the characteristics of English and Arabic orthographies, listening and reading comprehension in deep orthographies will predict lower performances.

Methodology

This section addresses the methods and research tools used. This study used the quantitative approach. The quantitative research paradigm therefore assumes that knowledge is “there,” waiting to be revealed, and it is the role of researchers to be “objective” and not to allow their attitudes, values, and beliefs to affect the research process. Epistemologically quantitative research is deductive and confirmatory (Friedman, 2013).

Research Participants

The study sample included 100 intermediate-advanced high school students (50 male students and 50 female students) aged 16-17. The selection criterion was based on a random sample from classrooms doing the four and five level unit English Bagrut (Israel’s high school matriculation exams). The sample was recruited from a high school in the northern district of Israel. All students were native Arabic speakers learning in an Arabic school, in which the teaching language is Arabic, Hebrew is learned as a second language, and English as a third language.

Research Tools

The following tests and tasks were administered (see Appendix A). All of the tests were built especially for this study except for the working memory test in Arabic and vocabulary test in English and Arabic.

1. Phonological Awareness Test in English and Arabic: Both versions were adapted from Morais, Cary, Alegria, and Bertelson (1979). Phonological awareness was tested by phoneme deletion. The participants were presented with 20 items and then asked to delete a phoneme from the beginning, the middle, or the end of a word. For example: repeat the word /jump/ without /j/. The percentage of correct responses out of the total was calculated for each participant.

2. Word Identification Test in English and Arabic: The English version was a subtest of the Woodcock Reading Mastery Test created by Woodcock (1973). Each participant was asked to read 40 words aloud in the English version and 30 words in the Arabic version (based on Arabic readers used in Arab high schools in Israel), which were listed in increasing order of difficulty. The percentage of correct responses out of the total was calculated for each participant.

3. Working Memory Test in English and Arabic: Both versions were adapted from the English version developed by Siegel and Ryan (1989). Participants were asked to fill in the missing words in sentences presented orally. Then they had to remember the words and repeat the missing words from that set in the correct order. There were a total of 12 sets of sentences (lengths ranging from 2 to 5 sentences). Examples are: In summer it is very ______, People go to see monkeys in a _______. The percentage of correct responses out of the total was calculated for each participant.

4. Orthographic Knowledge Test in English and Arabic: Both versions were adapted from the English version developed by Olson, Kliegel, Davidson, and Foltz (1985). The participants were presented with 20 homophonic pairs of words and in each pair, they were asked to mark the corrected spelled word. Examples of these pairs include /all-oll/. The percentage of correct responses out of the total was calculated for each participant.

5. Morphological Knowledge Test in English and Arabic: Both versions were inspired by Kahn-Horwitz (2006). The participants were presented with 10 sentences, and they were asked to fill in the missing word in the sentence from a list of words from the same family of words beneath each sentence in each version. For example, the boy eats (quick/ quickly/quickable). The percentage of correct responses out of the total was calculated for each participant.

6. Syntactic Judgment Test in English and Arabic: The tests appeared in Author and Sanitsky (2010) and Santiskty (2013). The participants were presented with 10 sentences and were asked to decide whether the sentence’s syntax was correct or not. For example, the girl reading a book. The percentage of correct responses out of the total was calculated for each participant.

7. Spelling Test in English and Arabic: Both versions are adapted from the English WRAT-R spelling tests (Jastak & Wilkinson, 1984). This skill was tested through dictation. The participants were asked to write down 40 words correctly in increasing levels of difficulty as they were read aloud. The list of words in English were taken from Band III core word list in the Israeli English Curriculum, such as the word /natural/. The list of words in Arabic were selected from the Arabic readers used in Arab high schools in Israel, such as the word /مبادئ/. The percentage of correct responses out of the total was calculated for each participant.

8. Reading Comprehension Test in English and Arabic: The tests appeared in Author and Sanitsky, (2010) and Sanitisky (2013). The participants were asked to read a text that was followed by 10 multiple choice comprehension questions. In the English version, the text was taken from the Bagrut examination in English (Module E) for four and five unit levels. In the Arabic version, the text was taken from the Bagrut examination in Arabic. The percentage of correct responses out of the total was calculated for each participant.

9. Listening comprehension Test in English and Arabic: Both versions were adapted from [34]. The listening comprehension in English was taken from the Bagrut examination in English (Module E) for four and five unit levels in English. The listening comprehension in Arabic was taken from a recorded TV news interview in Arabic. In both versions, the participants answered 10 multiple choice questions after they listened to passages. The percentage of correct responses out of the total was calculated for each participant.

10. Vocabulary Test in English and Arabic: Both versions were adapted from the English version of The Peabody Picture Vocabulary Test, (3rd edition) developed by Dunn and Dunn (1997). The vocabulary task measured receptive vocabulary. The students were shown four different pictures and were asked to point at the one matching the target word. For example, when the students heard the word bell, they had to point at the picture that matches the word they heard. The percentage of correct responses out of the total was calculated for each participant.

11. Speed Test in English and Arabic (for listening): The test consisted of three parts with three different texts in each part. The first part was quick reading, the second part was medium-paced reading, and the third was slow reading. In each part, the students were asked to answer 10 multiple-choice questions. In the English version, the audios were taken from the Bagrut examination in English (Module E) for four and five unit levels. In the Arabic version, the audio was taken from a recorded TV news interview in Arabic The percentage of correct responses out of the total was calculated for each participant.

12. Attitudes toward the Language and Target Group: The test appeared in [23] The participants were asked to answer a questionnaire which tested a few constructs, such as integrative motivation: indoor integrativeness and outdoor integrativeness, instrumental motivation, and attitude toward the learning situation in class. Statements were asked about each construct and participants were expected to answer on a five levels Likert scale of 1 (strongly disagree) and 5 (strongly agree). The reliability was reported α= .86 which indicates a high reliability.

Research Procedure

The participants were tested in the school that they attended during the school day. Participants were tested individually and collectively by the researcher in quiet rooms. Some tests were carried out collectively like orthographic knowledge, morphological knowledge, syntactic judgment, spelling, reading comprehension, listening comprehension, speed, attitudes toward the language and target group, while other tests were carried out individually. All instructions were given in Arabic, L1. The testing was held in two sessions for each student. Each session lasted between 50-60 minutes. In each session, all tests were given in one of the two languages. The tests were administered in the following order: phonological awareness, word identification, working memory, orthographic knowledge, morphological knowledge, syntactic judgment, spelling, reading comprehension, listening comprehension, vocabulary, speed, and attitudes toward the language and target group.

Data Analysis

Descriptive statistics were calculated for all variables involved in this study (averages, standard deviations, ranges, in addition to Skewness and Kurtosis indices). In the next stage, correlations indices (Pearson’s correlation coefficient) within and across languages were conducted to analyze the relationships between variables in this study. Next, an analysis of variance using ANOVA/ Multivariate linear regression analysis was performed to determine whether there were significant differences between Arabic and English tests and which variables were important predictors of listening and reading comprehension in Arabic as the first language and listening for comprehension in English as a Foreign Language.

Results

In the first stage, the descriptive values will be given to the research variables, and in the second stage, the research hypotheses will be answered. The descriptive statistics for all variables involved in this study are presented in Table 1.

Table 1: ANOVA Test and Descriptive statistics between research groups: dyslexic, chronological age-matched group and reading level matched group.

A-Normal Readers-CA B-Dyslexic Students C-RL Controls F η²
M S.D. M S.D. M S.D.
Reading ability

 

reading vowelized words 33.60 4.40 12.50 3.22 11.23 2.67 385.005*** .898

reading un-vowelized words

32.97 4.95 14.33 3.01 12.47 2.08 305.120*** .875
  Working Memory

 

12.63 1.94 4.17 1.23 3.48 1.33 328.911*** 0.884
  Orthographic processing

 

orthographic processing 89.00 7.38 72.13 7.62 64.38 10.04 66.320*** 0.607
  orthographic processing time (Sec.) 399.40 68.94 451.53 87.60 465.21 70.76 6.155*** 0.125
  Phonological awareness

 

phonological awareness 1 13.79 3.49 4.27 2.57 4.45 1.45 122.356*** 0.744
  phonological awareness 2 time 146.71 51.16 158.50 28.98 161.55 29.82 1.222 0.028
  phonological awareness 3 13.32 4.94 4.93 1.91 4.62 2.50 62.046*** 0.596
morphological awareness

 

29.45 9.62 11.27 8.22 7.64 3.23 70.778*** 0.622
morphological judgment 19.73 0.64 16.53 2.74 16.69 2.85 18.265*** 0.298
  Pseudo word decoding

 

pseudo word decoding 21.27 2.70 9.93 3.02 9.69 2.47 173.721*** 0.802
  pseudo decoding time (sec.) 96.57 33.03 158.33 27.62 162.93 22.30 51.999*** .0547
  Spelling 20.43 2.81 11.43 4.41 11.41 5.20 44.792*** 0.510
  RAN Errors

 

RAN numbers L2 Error 0.03 0.18 0.21 0.56 0.10 0.31 1.536 0.035
  RAN letters L5 Error 0.37 0.85 0.62 0.82 0.66 1.42 0.649 0.015
  RAN objects L7 Error 0.37 0.85 0.79 0.86 0.66 0.72 2.116 0.047
  RAN colors L9 Error 0.53 0.73 0.86 1.03 0.86 1.19 1.076 0.025
  RAN Time

 

RAN numbers L2 Error 28.77 9.19 29.00 5.50 32.55 4.28 2.956 0.064
  RAN letters L5 Error 36.47 8.65 40.03 7.70 42.10 10.11 3.062 0.066
  RAN objects L7 Error 47.20 8.06 44.77 6.01 47.45 5.87 1.444 0.032
  RAN colors L9 Error 47.83 10.61 50.23 8.36 53.62 7.89 3.041 0.066

***p<.001

Testing the Study’s Hypotheses

Hypothesis 1

The first hypothesis was that orthographic differences between Arabic and English would suggest distinct predictors between listening and reading comprehension in Arabic as the first language and listening and reading comprehension in English as a foreign language. To test this hypothesis, in the first stage, we examined the correlation between the variables by using the Pearson coefficient. The coefficient correlation (Table 2) was calculated between the scores of reading comprehension, and listening comprehension with all the other linguistic skills, each separately, once within the Arabic language and another within the English language. The results indicate a statistically significant difference between the two languages.

Table 2: ANOVA Test and Descriptive statistics between level’s RAN tasks

numbers letters objects colors F η²
M

 

S.D. M

 

S.D. M

 

S.D. M

 

S.D.
RAN errors by task type.

 

RAN Error .11 .38 .55 1.06 .60 .82 .75 1.00 11.545*** 0.120
RAN time by task type.

 

RAN Time 30.08 6.83 39.51 9.07 46.46 6.76 50.53 9.25 239.362*** 0.736

***p<.001

Table 2 shows the correlation coefficient between reading comprehension and listening comprehension, with Arabic/English Skills (variables), within every language. It shows that reading comprehension skills in both Arabic and English had a positive and significant correlation and had weak-medium intensity (.22, .35, respectively), with the phonological awareness skills. Also, listening comprehension skills in both Arabic and English were positively and significantly correlated and had weak-medium intensity (.26, .31, respectively), with the phonological awareness skills.

Reading comprehension in Arabic had no significant correlation with orthographic knowledge in Arabic, while the reading comprehension in English had a positive correlation, with weak intensity (.25), with orthographic knowledge in English. In contrast, listening comprehension skill in both Arabic and English had a positive and significant correlation and a weak-medium intensity (.22, .4, respectively), with the orthographic knowledge skills.

Reading comprehension in Arabic had no significant correlation with morphological knowledge in Arabic, while the reading comprehension in English had a positive correlation, with medium intensity (.53), with morphological knowledge in English. In contrast, the listening comprehension skills in both Arabic and English had a positive and significant correlation and a weak-medium intensity (.20, .52, respectively), with the morphological knowledge skills.

Reading comprehension skills in both Arabic and English had a positive and significant correlation and has weak-medium intensity (.25, .51, respectively), with the syntactic judgment skills. In contrast, listening comprehension in Arabic had no significant correlation with syntactic judgment in Arabic, while listening comprehension in English had a positive correlation, with weak intensity (.25), with syntactic judgment in English.

Reading comprehension skills in both Arabic and English had a positive and significant correlation and has weak-medium intensity (.24, .51, respectively), with the spelling skills. Also, listening comprehension skills in both Arabic and English was positively and significantly correlated and had weak-medium intensity (.21, .37, respectively), with the spelling skill.

Reading comprehension skills in both Arabic and English had no significant correlation with vocabulary skills. In contrast, listening comprehension in Arabic had no significant correlation with vocabulary in Arabic, while listening comprehension in English had a positive correlation, with weak intensity (.25), with vocabulary in English.

Reading comprehension skills in both Arabic and English had a positive and significant correlation and a weak-medium intensity (.22, .55, respectively), with the speed (0.75) skills. Also, listening comprehension skills in both Arabic and English had a positive and significant correlation and strong intensity (.74, .94, respectively), with the speed (0.75) skills.

Reading comprehension in Arabic had no significant correlation with speed (1.25) in Arabic, while reading comprehension in English had a positive correlation, with medium intensity (.44) with speed (1.25) in English. In contrast, the listening comprehension skills in both Arabic and English had a positive and significant correlation and a strong intensity (.89, .92, respectively), with the speed (1.25) skill.

Lastly, we should mention that listening and reading comprehension skills in both Arabic and English did not have any significant correlation with the word identification skills, working memory skills, and attitudes toward the English language.

In the second stage, the relationship between the variables was tested by adjusting multiple linear regression using the Stepwise method, to predict reading comprehension and listening comprehension skills in Arabic/English by skills in Arabic/English, respectively, as predictors. In other words, this stage sought to predict reading comprehension and listening comprehension skills in Arabic based on the other skills in the Arabic language, and then reading comprehension and listening comprehension skills in English based on the other skills in the English language as predictors.

The first dependent variable examined was reading comprehension. Table 3 contains the parameter estimates of the predictor’s variables—all the significant linguistic skills within every language.

Table 3: ANOVA Test and Descriptive statistics for reading time between research groups: dyslexic, chronological age matched group and reading level matched group.

A-Normal Readers-CA B-Dyslexic Students C-RL Controls F η²
M

 

S.D. M

 

S.D. M

 

S.D.
Speed of processing in reading (Time).

 

orthographic awareness E time (Sec.) 399.00 70.79 451.53 87.60 465.21 70.76 5.855*** 0.122
phonological awareness F time 146.71 51.16 158.50 28.98 161.55 29.82 1.222 0.028
pseudo decoding time (sec.) 96.68 33.98 158.33 27.62 162.93 22.30 48.661*** .0537
average time (sec.) 214.13 30.44 256.12 34.64 263.23 32.33 18.873*** 0.310

Table 3 shows that Phonological awareness and spelling skills in Arabic were significant (p<0.05) predictors of reading comprehension in Arabic. The predictors positively affected Reading comprehension in Arabic and were able to explain about 17% of the variance of reading comprehension in Arabic.

In Contrast, speed (0.75), syntactic judgment, and spelling skills in English were significant (p<0.05) predictors for reading comprehension in English. The predictors positively affected reading comprehension in English and were able to explain about 50% of the variance of reading comprehension in English.

The second dependent variable examined was listening comprehension. Table 3 contains the parameter estimates of the predictor’s variables—all the significant linguistic skills within every language.

Table 3 shows that Phonological awareness and orthographic knowledge skills in Arabic were significant (p<0.05) predictors for listening comprehension in Arabic. Both positively affected the listening comprehension in Arabic and were able to explain about 10% of the variance of listening comprehension in Arabic.

In contrast, morphological knowledge, orthographic knowledge, word identification, and spelling skills in English were significant (p<0.05) predictors for listening comprehension in English. All positively affected listening comprehension in English and were able to explain about 36% of the variance of listening comprehension in English.

In conclusion, a comparison of the predictors for reading comprehension in Table 3 shows that only the predictor of spelling was common between the two languages, while the other predictors for reading comprehension were different.

A comparison of the predictors for listening comprehension in Table 3 shows that only the predictor of orthographic knowledge is common between the two languages, while the other predictors for listening comprehension are not identical.

Accordingly, the first hypothesis is partially confirmed.

Hypothesis 2

The second hypothesis was that the characteristics of English and Arabic orthographies would predict lower performances in listening and reading comprehension in deep orthographies.

To examine this hypothesis, in the first stage, the correlation between the variables was tested using the Pearson coefficient. The coefficient correlation (Table 4) was calculated between the scores of reading comprehension, and listening comprehension in English, with the Arabic language skills. The results indicate that most skills in Arabic are statistically significance in terms of both reading comprehension and listening comprehension in English, except for the predictor of orthographic knowledge in Arabic.

Table 4: ANOVA Test and Descriptive statistics for general reading ability between research groups: dyslexic, chronological age matched group and reading level matched group.

A-Normal Readers-CA B-Dyslexic Students C-RL Controls F η²
M

 

S.D. M

 

S.D. M

 

S.D.
General reading ability scores.

 

reading ability-general (0-106) 90.13 10.47 35.13 5.93 31.73 4.18 595.839*** .932
working memory-general 12.63 1.94 4.17 1.23 3.48 1.33 328.911*** 0.884
orthographic awareness general 89.00 7.38 72.13 7.62 64.38 10.04 66.320*** 0.607
phonological awareness general 27.11 7.61 9.20 3.80 9.07 2.70 117.764*** 0.737
morphological awareness general 49.18 10.03 27.80 9.46 24.33 5.17 74.046*** 0.633
pseudo word decoding 21.27 2.70 9.93 3.02 9.69 2.47 173.721*** 0.802
spelling 20.43 2.81 11.43 4.41 11.41 5.20 44.792*** 0.510

Table 4 shows the correlation coefficient between Reading comprehension and listening comprehension in English, with Arabic skills (variables). Table 4 shows that reading comprehension and listening comprehension skills in English had a positive and significant correlation and a medium intensity (.33, .31, respectively), with the phonological awareness skills.

Reading comprehension in English had no significant correlation with orthographic knowledge in Arabic while listening comprehension in English had a positive correlation and a weak intensity (.25), with orthographic knowledge in Arabic.

Also, reading comprehension and listening comprehension skills in English had a positive and significant correlation and a medium intensity with syntactic judgment (.36, .28, respectively), spelling (.41, .24, respectively), reading comprehension (.67, .45, respectively), listening comprehension (.39, .46, respectively), speed (0.75) (.39, .36, respectively), speed (1.25) (.32, .41, respectively).

Lastly, we should mention that the reading comprehension and listening comprehension skills in English had no significant correlation with any variables of word identification, working memory, morphological knowledge, and vocabulary.

In the second stage, to examine this hypothesis, we used adjusting multiple linear regression using the Stepwise method, to predict English language skills (reading comprehension and listening comprehension) by language skills (variables) in Arabic as predictors.

The first dependent variable examined was reading comprehension. Table 5 contains the parameter estimates of the predictor’s variables—all the significant linguistic skills in the Arabic language.

Table 5: Pearson correlation results between the variables measured in the study

1 2 3 4 5 6 7
1. phonolory_reading_ability_general
2. working_memory_general .938**
3. orthographic_awareness_general .770** .705**
4. phonological_awareness_general .894** .836** .664**
5. morphological_awareness_general .821** .800** .650** .756**
6. pseudo_word_decoding_general .927** .861** .758** .853** .782**
7. Spelling_general .753** .692** .816** .716** .643** .784**
8. RAN_general -.268* -.203 -.282** -.285** -.224* -.275** -.356**

**p<0.01 *p<0.05

Table 5 shows that reading comprehension, speed (0.75), spelling, and syntactic judgment skills in Arabic were significant (p<0.05) predictors of reading comprehension in English. The predictors positively affected reading comprehension in English and were able to explain about 58% of the variance of reading comprehension in English.

The second dependent variable examined is listening comprehension. Table 5 contains the parameter estimates of the predictor’s variables—all the significant linguistic skills in the Arabic language.

Table 5 shows that listening comprehension and reading comprehension skills in Arabic were significant (p<0.05) predictors of listening comprehension in English. The predictors positively affected listening comprehension in English and were able to explain about 34% of the variance of listening comprehension in English.

In conclusion, the Arabic skills predictors for reading comprehension in English (Table 5) are reading comprehension, speed (0.75), spelling, and syntactic judgment skills. In contrast, the Arabic skills predictors for listening comprehension in English (Table 5) are listening comprehension and reading comprehension skills. Accordingly, the second hypothesis is confirmed.

In summary, the results showed that the first hypothesis was partially confirmed. While it was hypothesized that orthographic differences between Arabic and English suggested distinct predictors between listening and reading comprehension in Arabic and listening and reading comprehension in English, spelling was a common predictor between the two languages in reading comprehension, and orthographic knowledge was a common predictor between the two languages in listening comprehension. The second hypothesis was confirmed: Considering the characteristics of English and Arabic orthographies, listening and reading comprehension in deep orthographies predicted lower performances.

Discussion

The main goal of the current research was to investigate how listening and reading comprehension among native Arabic speakers predict the use of Arabic and English language orthographies in learning English as a foreign language (FL) in Israel. The novel aspect of this research is examining listening and reading comprehension among Arabic learners of English in relation to their different orthographies in a single study. The existing research has many problems in representing predictors of listening and reading comprehension in Arabic as the first language and English as a foreign language concerning their distinct orthographies. Previous studies showed mixed results concerning the role of language orthography in listening and reading comprehension. In an attempt to fill the gap, this study presents an analysis of significant differences between Arabic and English tests and the variables that are important predictors of listening and reading comprehension in Arabic as the first language and listening for comprehension in English as a foreign language.

According to the research findings, the first research hypothesis was partially confirmed, meaning that that only the predictor of spelling is common between the two languages, and the other predictors for reading comprehension are different. Phonological awareness in Arabic is a significant predictor of reading comprehension in Arabic, while speed (0.75) and syntactic judgment in English are significant predictors of reading comprehension in English. These findings are in line with previous studies that reported that in shallow orthographies, learners depend more on phonology in word decoding and word learning (Author et al., 2013; 10; Jiang, 2017). In addition, the development of literacy skills such as reading and spelling are learned more quickly in consistent orthographies when compared to inconsistent orthographies (Caravolas et al., 2012). Regarding the predictors of reading comprehension in English, speed (0.75) indicates a significant predictor of reading comprehension in English, suggesting that slower reading in listening comprehension contributes to better performance in reading comprehension in English. Regarding syntactic judgment, the findings are in accordance with previous studies that suggest that syntax relates to reading comprehension, and improvement in syntax contributes positively to reading comprehension among L2 learners of English (Gottardo et al., 2018).

Furthermore, only the predictor of orthographic knowledge is common between the two languages, while the other predictors for listening comprehension are not identical. Phonological awareness in Arabic predicts listening comprehension in Arabic, while morphological knowledge, word identification, and spelling predict listening comprehension in English. This aligns with the previous studies that showed that the varying degree of orthography between languages affects the development of reading and spelling, as deep orthographies impede spelling skills compared to shallow orthographies (Andreou, 2016). In addition, word recognition highly contributes to reading comprehension among beginner readers while listening comprehension appears to be strongly related to advanced readers (Babayiğit & Shapiro, 2020). Furthermore, shallow orthographies are often complicated morphological systems while deep orthographies are less complicated (Author & Shakkour, 2014; Author et al., 2013). These findings on the differences between Arabic and English predictors of listening and reading comprehension in Arabic and listening and reading comprehension in English shed light on the fact that learners with different orthographic backgrounds adapt distinct linguistic skills to learn the language. In addition, the transfer of linguistic and language skills is affected by the degree of similarity between the two languages (Author et al., 2013; 34,38]. Therefore, the results of the current study prove that distinct orthographic backgrounds of L1 and L2 influence the use of language skills in listening and reading comprehension in both languages.

The second research hypothesis was fully confirmed, meaning that the Arabic skills predictors for reading comprehension in English are different from the Arabic skills predictors for listening comprehension in English. Reading comprehension, speed (0.75), spelling, and syntactic judgment skills in Arabic are significant predictors of reading comprehension in English. However, listening comprehension and reading comprehension skills in Arabic are significant predictors of listening comprehension in English. These results are in line with previous studies that showed that listening comprehension and reading comprehension are similar skills but constitute two distinct forms of comprehension involving different cognitive processes (Author 2019a; Diakidoy et al., 2005; Taha, 2016; Tobia & Bonifacci, 2015; Wolf et al., 2019). Moreover, the Arabic predictors of listening and reading comprehension in English demonstrate that due to the orthographic background differences between Arabic and English, learners had to use distinct skills in their L1 in order to perform well in English.

Conclusion

The present study explored to what extent first language skills predict listening and reading comprehension in English and to what degree the predictors of listening and reading comprehension in Arabic are distinct from listening and reading comprehension predictors in English. The findings of the study proved that the performance of listening and reading comprehension in the two languages is affected by the different orthographic system of each language. Additionally, these findings add to the body of literature of high school Arabic learners of English as a foreign language.

The present study has some significant empirical and instructional recommendations regarding the teaching and learning of English as a foreign language for Arabic speakers. Firstly, the different orthographies of the Arabic and English languages should be taken into consideration in teaching English as foreign language among native speakers of Arabic. Secondly, teaching Arabic should focus on phonological awareness, orthographic knowledge, and spelling skills for better performance in listening and reading comprehension in Arabic. Thirdly, teaching English should focus on speed, syntactic judgment, morphological knowledge, word identification, orthographic knowledge and spelling skills for better performance in listening and reading comprehension in English. It was crucial to conduct such research as limited attention has been given to listening and reading comprehension in language acquisition in the context of their different orthographies. The main contributions of this study are understanding the difficulties that students might face in learning Arabic and English as high school learners and reconsidering the teaching of Arabic and English in relation to their different orthographies.

Limitations and Future Research

The present study has few limitations that should be taken into consideration and in interpreting the results. One of the limitations of this study is the sample prevents generalization. The sample concerns a specific group of a limited number of students belonging to a certain age group and background. Another limitation of this study is the use of constructed assessments for assessing the language skills in Arabic and English, as standardized measures for assessing these skills among high school aged native Arabic speakers’ learners of English as a third language are unavailable. Despite these limitations, the present study expands the existing knowledge in the field of language education. Future studies should include a larger sample of participants from different backgrounds and ages. Further, validated measures for assessing language skills should be included.

References

  1. Edele A, Stanat P (2016) The role of first-language listening comprehension in second-language reading comprehension. Journal of Educational Psychology 108(2): 163-180.
  2. Sparks RL, Patton J, Ganschow L, Humbach N, et al. (2008) Early first-language reading and spelling skills predict later second-language reading and spelling skills. Journal of Educational Psychology 100(1): 162-174.
  3. Author S (2019a)
  4. Diakidoy IAN, Stylianou P, Karefillidou C, Papageorgiou P (2005) The relationship between listening and reading comprehension of different types of text at increasing grade levels. Reading Psychology 26(1): 55-80.
  5. Taha H (2016) Deep and shallow in Arabic orthography: New evidence from reading performance of elementary school native Arab readers. Writing Systems Research 8(2): 133-142.
  6. Tobia V, Bonifacci P (2015) The simple view of reading in a transparent orthography: The stronger role of oral comprehension. Reading and Writing 28(7): 939-957.
  7. Wolf MC, Muijselaar MM, Boonstra AM, de Bree EH (2019) The relationship between reading and listening comprehension: shared and modality-specific components. Reading and Writing 32(7): 1747-1767.
  8. Cadime I, Rodrigues B, Santos S, Viana FL, et al. (2017) The role of word recognition, oral reading fluency and listening comprehension in the simple view of reading: a study in an intermediate depth orthography. Reading and Writing 30(3): 591-611.
  9. Tobia V, Bonifacci P (2015) The simple view of reading in a transparent orthography: The stronger role of oral comprehension. Reading and Writing 28(7): 939-957.
  10. Feder L, Author S (2020) An examination of differences in linguistic and meta-linguistic skills in English (FL) and Hebrew (L1): English intervention program for dyslexic, poor and normal readers. The Journal of Educational Research 113(3): 226-243.
  11. Author S, Shakkour W, Siegel L (2013)
  12. Author S, Hijjazi E (2020)
  13. Author S (2019b)
  14. Asadi IA, Khateb A, Shany M (2017) How simple is reading in Arabic? A cross‐sectional investigation of reading comprehension from first to sixth grade. Journal of Research in Reading 40(S1): S1-S22.
  15. Author S, Shakkour W (2014)
  16. Author S, Siegel LS (2003)
  17. Caravolas M, Lervåg A, Mousikou P, Efrim C, et al. (2012) Common patterns of prediction of literacy development in different alphabetic orthographies. Psychological Science 23(6): 678-686.
  18. Author S (2019a)
  19. Author S (2019b)
  20. Author S, Hijjazi E (2020)
  21. Ibrahim R, Eviatar Z, Aharon-Peretz J (2002) The characteristics of Arabic orthography slow its processing. Neuropsychology 16(3): 322-326.
  22. Author S (1998)
  23. Taha H (2016) Deep and shallow in Arabic orthography: New evidence from reading performance of elementary school native Arab readers. Writing Systems Research 8(2): 133-142.
  24. Asadi IA, Author S (2019) The impact of the position of phonemes and lexical status on phonological awareness in the diglossic Arabic language. Journal of Psycholinguistic Research 48(5): 1051-1062.
  25. Al-Janaideh R, Hipfner-Boucher K, Cleave P, Chen X (2021) Contributions of code-based and oral language skills to Arabic and English reading comprehension in Arabic-English bilinguals in the elementary school years. International Journal of Bilingual Education and Bilingualism 25(7): 1-16.
  26. Hussien AM (2014) The effect of learning English (L2) on learning of Arabic literacy (L1) in the primary school. International Education Studies 7(3): 88-98.
  27. Andreou G, Segklia M (2019) Cross‐linguistic skills transfer from the second/foreign language to the first among students with learning disabilities after an intervention program in the second language. Creative Education 10(5): 1023-1036.
  28. Author S, Siegel LS (2002)
  29. Miller RT (2019) English orthography and reading. In J.I. Liontas (Ed. ): The TESOL Encyclopedia of English Language Teaching 1(7)
  30. Caravolas M, Lervåg A, Defior S, et al. (2013) Different patterns, but equivalent predictors, of growth in reading in consistent and inconsistent orthographies. Psychological Science 24(8): 1398-1407.
  31. Feder L, Author S (2022) Cognitive Retroactive Transfer of Language Skills from English as a Foreign Language to Hebrew as the First Language. Journal of Learning Disabilities 55(3): 213-228.
  32. Author S, Siegel LS (2002)
  33. Wade‐Woolley L (1999) First language influences on second language word reading: All roads lead to Rome. Language Learning 49(3): 447-471.
  34. Edele A, Stanat P (2016) The role of first-language listening comprehension in second-language reading comprehension. Journal of Educational Psychology 108(2): 163-180.
  35. Gottardo A, Mirza A, Koh PW, et al. (2018) Unpacking listening comprehension: The role of vocabulary, morphological awareness, and syntactic knowledge in reading comprehension. Reading and Writing 31(8): 1741-1764.
  36. Babayiğit S, Shapiro L (2020) Component skills that underpin listening comprehension and reading comprehension in learners with English as first and additional language. Journal of Research in Reading 43(1): 78-97.
  37. Goodwin AP, Petscher Y, Tock J (2020) Morphological supports: Investigating differences in how morphological knowledge supports reading comprehension for middle school students with limited reading vocabulary. Language, Speech, and Hearing Services in Schools 51(3): 589-602.
  38. Jiang X (2017) Lower-level processing skills in English-as-a-second-language reading comprehension: Possible influence of first language orthography. Studies in English Language Teaching 5(3): 2329-3111.
  39. Elkhafaifi H (2005) The effect of pre listening activities on listening comprehension in Arabic learners. Foreign Language Annals 38(4): 505-513.
  40. van Zeeland H, Schmitt N (2013) Lexical coverage in L1 and L2 listening comprehension: The same or different from reading comprehension? Applied Linguistics 34(4): 457-479.
  41. Author S, Bluestein-Danon D (2012)
  42. Hamada M, Koda K (2008) Influence of first language orthographic experience on second language decoding and word learning. Language Learning 58(1): 1-31.
  43. Andreou G (2016) Dyslexia and spelling in two different orthographies (Greek vs. English): a linguistic analysis. Journal of Advances in Linguistics 7(1): 1172-1192.
  44. Sipra M (2013) Impact of English orthography on L2 acquisition. English Language Teaching 6(3): 116-124.
  45. Author S (2)
  46. Author S, Share D, Mansour MS (2003)
  47. Author S (2003)
  48. Elyildirim S, Ashton S (2006) Creating positive attitudes towards English as a foreign language, English Teaching Forum 44(4): 2-21.
  49. Gömleksiz MN (2010) An evaluation of students’ attitudes toward English language learning in terms of several variables. Procedia-Social and Behavioral Sciences 9: 913-918.
  50. Oroujlou N, Vahedi M (2011) Motivation, attitude, and language learning. Procedia-Social and Behavioral Sciences 29: 994-1000.
  51. Ghazvini SD, Khajehpour M (2011) Attitudes and motivation in learning English as second language in high school students. Procedia-social and Behavioral Sciences 15: 1209-1213.

Advancing Mind Genomics: Using AI (Artificial Intelligence) to Generate Topics, Questions, Messages as Answers, and ‘Synthesized’ Minds (Respondents)

DOI: 10.31038/PSYJ.2023581

Abstract

AI created a resource bank of statements about what a doctor might say to a child in order to deal with the child’s obesity. After the AI generated messages were developed, 16 of the messages (elements) were selected and combined into vignettes according to an underlying experimental design, whose specific combinations differed for each ‘respondent’. Each set of 24 vignettes comprised a stand-alone set of combinations and were evaluated by AI prompted to act as a specific person in the medical world (receptionist, doctor with 10 years of experience, nurse practitioner). Deconstruction of the ratings by regression showed the contribution of each AI created message to the rating scale. The coefficients ‘made sense’ when the regression was done according to ‘WHO’ the AI was defined to be. Further clustering the coefficients across the respondents revealed two clearly different mind-sets. The systematic approach using AI as both the provider of ideas and the evaluator of these ideas presents a new vista for learning about how to communicate with people, using technology to dramatically accelerate and fine-tune that learning.

Introduction

It is hard to overestimate the excitement with which AI, artificial intelligence, has been greeted and adopted, especially since the introduction of Chat GPT, and associated technology [1]. One can scarcely read of any topic of huma endeavor without one or another pundit bringing up the impact of AI for that field. This paper looks at the potential of AI to synthesize ‘respondents’, with the goal of accelerating the learning of professionals who want to learn to counsel people in nutritional health. The use of synthesized people, personas, is not new, and has been a topic of interest for some decades now [2-4]. What is new is the vision of moving beyond personas derived from large scale studies to one-off studies created entirely by synthetic means.

This paper combines AI with Mind Genomics to develop a new system for training and education. The underlying vision is to accelerate knowledge development by having the AI provide topic-relevant ideas (Idea Coach in Mind Genomics), and then ‘personas’ created by artificial intelligence, based upon combinations of features of the way people think, who the people are etc.. The raw material for these personas come from ‘self-profiling classification questions’ that a researcher might ask a human respondent. In short, the paper presents a Mind Genomics study, with the materials, from beginning end under the control of the machine, not the researcher. All the researcher does is select ideas at the very start of the study, these ideas later being tested in the study itself.

The process of Mind Genomics begins with a series of questions, those questions telling a story, and then for each question provide four different answers. The actual experiment consists of combining these answers into small combinations of 2-4 answers, at most one answer from a question, but often no answer from a question. The 24 combinations, called vignettes, are evaluated by respondents. Each respondent evaluates a set of 24 different vignettes, the uniqueness of the sets of 24 vignettes ensured by a permutation algorithm [5]. The analysis, done by OLS, ordinary least squares regression, shows through the coefficients of a linear equation the degree to which the 16 elements, viz., answers to the question, drive the respondent’s rating.

During the evolution of Mind Genomics, a process taking place for more than 30 years, since its introduction in 1993 [6-8], the consistently hardest part of any effort, basic research or applied research, was developing the questions, and to a far lesser degree coming up with the answers to the questions. More than one study ended up being aborted simply because the researcher could not generate the four questions which tell the story. Once the four questions were developed, for the most part, researchers were able to push through to the four answer for that question. A solution to the issue of frustration in the creation of questions and answers emerged with the incorporation of AI into the process.

A third problem, motivating people, respondents, to participate, proved to be simple to solve because of the emergence of companies which provided paid panelists. Money solved the problem of participation, if not motivation. This paper will deal with the introduction of synthesized respondents, to reduce cost, and to facilitate new types of systematized investigations not possible before.

Mind Genomics requires systematized thinking about a topic, an ability that all too often needs to be learned through coaching. It was to provide this coaching that the original AI was introduced in mind-year, 2023, in the form of Idea Coach. This paper focuses on the further introduction of AI ‘synthesized respondents’, in an effort to make the Mind Genomics process a streamlined one, from beginning to end, appropriate for teaching as well as for practical application.

Explicating the Process-Part 1-Setting Up the Study Using AI

Figure 1 (Panel A) shows the request by the Mind Genomics set-up ‘template’ for the four questions, each to be addressed by four answers. It is the development of these four questions which become a difficult hurdle. The creation of the Idea Coach allows this topic to be addressed. Figure 1 (Panel B) shows the rectangle where the researcher can write out the question. The question posed to AI through Idea Coach is very simple: I am a doctor treating obesity in children. How do I talk to the children to make them understand. One could further fine-tune the Idea Coach by telling it to explicate the question in discussion form, as well as to provide questions of length 15 words or less, and questions understandable to a 12-year-old. Those statements become part of the query. The actual process is made as simple as possible so that the effort focuses on the topic.

fig 1

Figure 1: The templated screens requesting the researcher to provide four questions. Panel A shows the request for four questions which tell a story Panel B shows the rectangle inside which the researcher can describe the topic, and from which the Idea Coach returns with 15 questions. The actual text of the request is: I am a doctor treating obesity in children. How do I talk to the children to make them understand?

The actual short description appears as the topic in Table 1. The Idea Coach was run three times to generate a reservoir of questions. The Idea Coach is typically run 5-10 times, providing information which ends up teaching the researcher. The Idea Coach is also run several times for each of the four questions. The combination of different sets of 15 questions for a topic description and different sets of 15 answers for each question provides a unique resource booklet on the topic. Each iteration in Idea Coach lasts about 20 seconds, so that in five minutes one can produce 15 sets of 15 questions each. In the end, only four questions will be chosen.

The results from the first 15 questions appear in Table 1. The questions emerging from the AI embedded in Idea Coach are easily understood by a human being.

Table 1: Questions emerging from the Idea Coach which address the topic. The topic is provided by the researcher

tab 1

After the researcher receives the various sets of 15 questions, the next task is for the researcher to provide four questions. These questions can be taken from those suggested by the AI, either ‘as is’ or edited to tailor the ‘language’ and ‘style’ of the answer. The researcher may also contribute questions. Quite often the questions shown in Table 1 have to be modified, not so much for the respondent who never sees the questions, but rather for the AI to provide the proper format of the answer.

Table 2 shows the modified question, edited by the researcher, and submitted to the Idea Coach. In turn, for each question in Table 2, Idea Coach returned with sets of 15 answers, formatted in the way request by the researcher. Table 2 also shows the four answers to each question, these answers having been returned by AI (Mind Genomics’ Idea Coach), and then slightly edited to make them flow more easily. The rationale was to generate answers that could be given to the Idea Coach programmed to act as a human respondent.

Table 2: The four questions and the four answers to each question. The questions and the answers were edited slightly to make them understandable to human beings, but the language and meaning was maintained.

tab 2

Running the Study and Preparing the Data for Regression Modeling and for Clustering

Following the creation of the edited answers, the Mind Genomics platform was instructed to run a study with 301 synthetic respondents. The program was instructed to create a panel comprising approximately equal numbers of the three types of synthetic respondents defined by their job (receptionist, doctor with 10-years-experience, nurse practitioner). Then the Mind Genomics program presented 24 vignettes to the synthetic respondent, defining WHO the respondent is, defining the SCALE (Table 3), and then one vignette at a time to the AI ‘respondent’ with the request to rate the vignette on the two-sided scale by choosing one rating point. This means that the AI had to consider the vignette from the complex of how the patient would feel and how the doctor would feel. The Mind Genomics platform recorded the information about the respondent, the vignette, the rating, and the time elapsed for the synthesized respondent to rate the vignette.

Table 3: The preliminary question for assignment into respondent job (top) and then the ‘two-sided rating scale (bottom).

tab 3

Once the data was collected for a ‘respondent’ the AI returned the raw data to the Mind Genomics platform to create the database shown as an Excel file in Figure 2. Each respondent generates 24 rows of data, one row for each of the 24 vignettes. Figure 2 is divided into several sections, representing different aspects of the data and of the analysis. As we follow the structure of the file, we must keep in mind that as the data is being transferred to the database, there are preparatory transformations occurring in ‘real time,’ these transformation necessary for the analysis.

  1. Row-for the entire database. There are 301 respondents, each with 24 rows of data, generating 7224 rows, each row corresponding to a specific respondent and a specific vignette.
  2. Study and panelist number.
  3. The AI assignment of the respondent to one of three groups (receptionist, doctor with 10-years-experience, nurse practitioner by the membership of the synthesized respondent into one of two mind-sets, and then into one of three mind-sets.
  4. Columns showing test order and ‘half’ defined as 1 for test order 1-12, and 2 for test order 13-24, respectively.
  5. The 16 elements, A1-D4, coded as ‘1’ when present in the vignette, coded as ‘0’ when absent from the vignette.
  6. Rating, new variables R54x (patient motivated), R12x (patient not motivated), R52x (medical person feels the right thing was said), R41x (medical person thinks the wrong things were said), R3x (cannot answer), and RT (response time to the nearest 10th of a second. The new variables were created by adding the appropriate variables. In no case does the creation of a new variable produce any number other than 0 or 1. After these variables were created a vanishingly small random number was added to each new variable (viz., R54x, R12x, R52x, R41x, R3) to ensure that these newly created variables possessed minimal variability as required for analysis by regression.

fig 2

Figure 2: Example of database showing the actual information generated by the AI, and the set of responses to each vignette.

Using Regression Modeling to Link the 16 Elements to the Newly Created Binary Variables

The first analysis looks at the average ratings of the newly created binary variables (e.g., R54x, Patient Motivated). The question is whether the instruction to the AI to assume a certain persona (e.g., receptionist) has an effect on the average ratings across all the vignettes in which the AI assumed that it was a ‘receptionist’. Table 4 shows that the average ratings for a specific binary variable are quite similar across the three different ‘AI personas’. Our first conclusion leaves us with the concern that AI may not be able to perform the task in a way which makes sense.

Table 4: Average rating for five binary variables and ‘response time’ for three respondent personas created by AI and set to the task of rating the vignette. The data come from the averages of the newly created binary variables. Each average comes from approximately 2400 numbers, assuming that each synthesized persona comprised 100 respondents, each respondent evaluating 24 vignettes.

tab 4

The final analysis for this first run used OLS (ordinary least squares regression, to relate the 16 elements to the binary transformer rating. The equation is: Transformed Binary Variable=k1(A1) + k2(A2) + … k16(D4). That is, the regression model uses the data to show how the presence or absence of the element drives the binary variable. The least-squares regression can be run for the total panel, and for all respondents defined by the AI synthesizer as being ‘receptionist,’ ‘doctor with 10-years-experience’, or nurse practitioner.

Table 5 shows the regression coefficients, computed as if the ratings and therefore the binary variables (e.g., R54x) came from people. Relevant coefficients are shown in shaded cells. There may be a number of stories within the data, but no simple organizing principle. Experience with ratings generated by people produce the same story, namely some strong performers but not many, and stories that could be told, but seem too isolated.

Table 5: Regression coefficients for the key groups (receptionist, doctor with 10-years-experience, and nurse practitioner. The regression coefficients were estimated by OLS regression based upon the ratings of the vignette assigned by artificial intelligence.

tab 5(1)

tab 5(2)

A better way to look for ‘humanness’ in the data may be to search for strong-performing elements for each. As a further step, one might present these strong performing elements to others, and ask them how they feel about the motivating power of the elements, or how they feel about the elements in terms of want might be expected from someone in the medical profession. As a first approximation, there are no strong surprises in Table 6, which shows the strongest elements for each newly created binary variable (e.g., R54x, Patient Motivated), when the AI took on three of the personas.

Table 6: Strongest performing elements for three AI personas (receptionist, doctor, nurse practitioner) on four newly created binary variables.

tab 6

The final set of analyses, clustering, divides the respondents into mutually exclusive and exhaustive groups, called ‘clusters’ by statisticians, ‘segments’ by consumer researchers, and ‘mind-sets’ in the language of Mind Genomics. The underlying notion, foundational for Mind Genomics, is that ‘people’ differ systematically in the way they make decisions about the world of the everyday. The plethora of different products, services, even layouts of towns and the styles of houses and their decorations clearly announce these differences in judgment. Rather than considering this person-to-person variability to be an unwanted secondary factor, noise, in an otherwise simple world, Mind Genomics looks for organizing principles, so-called mind-sets. These mind-sets are derived empirically from a study of the differences among people in how those people evaluate the world of the everyday, at the granular level, not the 20,000-foot level. A variety of papers have been published on the use of Mind Genomics to identify these mind-sets in various situations and for various products.

The question for this study is whether mind-sets can be uncovered when we deal with synthetic respondents. The process to discover these mind-sets will certainly work with the data generated by AI because the input data needed to create the mind-sets is simply the set of coefficients, one per respondent, as shown in Table 5, specifically in this study for coefficients where R54x (patient motivated) is the dependent variable.

The process for creating mind-sets follows strict mathematical rules. The clustering is totally insensitive to the ‘meaning’ of the elements and does not care from where the coefficients came Mind-sets emerge after the researcher develops the equation for each of synthesized respondent, puts the data into a matrix of 301 rows (one row for each synthesized respondent, 16 columns (one column for each of the 16 coefficients from regression). The k-means clustering program [9] then creates groups of synthesized respondents whose patterns are similar across the 16 coefficients.

The process of creating the mind-sets is straightforward, using clustering. The process follows these steps:

  1. Create the basic equation for each respondent: R54x=k1A1 + k2A2 … k16 The equation has 16 coefficients, estimated from the 24 cases generated for each synthetic respondent.
  2. Estimate the ‘distance’ or ‘dissimilarity’ between each pair of the 301 respondents by computing the Pearson Correlation (R). Then create the new distance parameter, (1-R). The value (1-R) is 0 when the two sets of coefficients are parallel, meaning that the two items, our synthetic respondents, show identical patterns. The value (1-R) is 2 when the two sets of coefficients are opposite.
  3. Use clustering to assign respondents to one of two clusters, or later one of three clusters. The criterion is that the variability within a cluster should be ‘small’ because the respondents show similar patterns of coefficients. In contrast, the variability across the centroids of the clusters should be large because the clusters are different groups.
  4. Once the respondents are assigned to the appropriate cluster (which of the two clusters, which of the three clusters), recompute the equation using the data from all respondents in a cluster.

Table 7 shows the performance of the elements for the Total Panel, for the two mind-sets, and for the three mind-sets. Just looking at the Table shows a number of shaded cells with coefficients of 21 or higher. High coefficients by themselves do not suffice, however. Rather, the coefficients must ‘tell a story’, and allow for interpretation.

The first clustering creating two mind-sets produces easily interpreted mind-sets.

Table 7: Coefficients emerging from clustering the 301 synthetic respondents into two mind-sets and then three mind-sets, based on the pattern of the coefficients for R54x (Motivates).

tab 7

Mind-Set 1 of 2-Focus on Activity and Vitality

We can find fun ways to stay active and make healthy choices together.

Let’s talk about ways to keep your body strong and full of energy

Mind-Set 2 of 2-Focus on What Specifics to Do

Here is part of our program designed for you Motivate with positive and encouraging words.

Here is part of our program designed for you Involve the child in grocery shopping and meal planning.

Here is part of our program designed for you: Share inspiring success stories of people who achieved their weight loss goals.

In contrast, the three mind-set-solution produces elements with higher coefficients, but the underlying pattern is hard to interpret.

Our final analysis considers the performance of the elements using the IDT, Index of Divergent Thought [10]. The IDT attempts to quantify the degree to which the clustering generates truly different groups of people based upon the coefficients. Table 8 shows the computations. Optimal levels of the IDT are found in the range of 70-75. Higher values of the IDT (e.g., 80 or higher) mean that there are many high coefficients but not dramatically patterns of coefficients across the mind-sets Lower values of the IDT (e.g., 60 or lower) mean that there are many low coefficients, and once again the pattern of differences in coefficients across mind-sets is simply not dramatic.

For this study, and for others not reported here, the pattern of low values for the IDT continues to emerge when we deal with synthetic respondents. Here it is 47. Simply stated, the synthetic respondents may ‘work’ but do not yet produce dramatically stronger performance. As a starting point, however, it is gratifying to see that initial exploration into the AI does produce interpretable mind-sets.

Table 8: Calculation of the IDT, Index of Divergent Thought, for the synthesized data. The IDT is based on clustering coefficients estimated for R54x, patient is motivated.

tab 8

Discussion and Conclusions

The emerging interest in AI generated respondents, so-called synthetic respondents, provides a new area of opportunity for the equally emerging science of Mind Genomics. As shown here, it is straightforward to craft a series of prompts to AI for a specific topic, these prompts being a description of ‘WHO’ the person is (our three medical professionals), how the person is to ‘JUDGE’ (the rating scale), and finally ‘WHAT’ the person is to judge (the vignette).

The Mind Genomics task is difficult for people. It presents combinations of elements which may or may not fit together, but which at least do not contradict each other. Yet, human beings can do it. What is remarkable is that AI can do the task, perhaps not as well as people because of the lower coefficients, but nonetheless AI can do the job.

What is most remarkable is that AI with synthetic respondents can deal with the two-sided scale, one side for motivating or not motivating the patient, the second side for the right versus the wrong thing said.

‘Looking to the meaning of the data, we can focus on both the philosophical issue of the ‘Turing Test’ and the use of the approach to create a body of knowledge for teaching. The issue of the Turing Test is a well known one in philosophy. Quite simply, can we create a test which to figure out whether a machine is a machine or a human being. The data here suggest that the Mind Genomics process can be reasonably mimicked by a machine, with the answers ‘making sense.’

Following quickly on the heels of the foregoing question is whether or not the Mind Genomics system can be engineering to become a teaching/learning system, wherein we design the persona to have a variety of emotional and other issues, and then evaluate the response of alternative descriptions of treatments. The sheer number of papers dealing with this issue of learning about interactions between groups of people is heartening [11-13]. This second avenue is likely to be the one more interesting, and ultimately more fruitful to researchers, to philosophers and to society alike.

Acknowledgment

The senior author, HRM, dedicates this paper to the memory of a mentor whom he never met, but who was instrumental in his thinking since 1965. The mentor is the late Harvard University professor, Anthony Gervin Oettinger of blessed memory, who laid the foundation of HRM’s interest in artificial intelligence. It was Professor Oettinger who planted the seeds of this paper almost six decades ago, in his offer to have the author participate in the 1960’s Harvard project, TACT, Technical Aids to Creative Thought. Thank you Tony. This paper is for you.

References

  1. Dave T, Athaluri SA, Singh S (2023) ChatGPT in medicine: an overview of its applications, advantages, limitations, future prospects, and ethical considerations. Frontiers in Artificial Intelligence 6: p.1169595. [crossref]
  2. Campbell RT, Hudson CM (1985) Synthetic cohorts from panel surveys: An approach to studying rare events. Research on Aging 7: 81-93. [crossref]
  3. Dang HAH, Dabalen AL (2019) Is poverty in Africa mostly chronic or transient? Evidence from synthetic panel data. The Journal of Development Studies 55: 1527-1547.
  4. Dang HAH, Lanjouw PF (2018) Poverty dynamics in India between 2004 and 2012: Insights from longitudinal analysis using synthetic panel data. Economic Development and Cultural Change 67: 131-170.
  5. Gofman A, Moskowitz H (2010) Isomorphic permuted experimental designs and their application in conjoint analysis. Journal of Sensory Studies 25: 127-145.
  6. Moskowitz HR (2012) ‘Mind genomics’: The experimental, inductive science of the ordinary, and its application to aspects of food and feeding. Physiology & Behavior 107: 606-613.
  7. Moskowitz HR, Gofman A (2007) Selling Blue Elephants: How to Make New Products That People Want Before They Even Know They Want Them. Pearson Education.
  8. Moskowitz HR, Martin D (1993) How Computer Aided Design and Presentation of Concepts Speeds up the Product Development Process. Proceedings of the ESOMAR Congress Copenhagen.
  9. Likas A, Vlassis N, Verbeek JJ (2003) The global k-means clustering algorithm. Pattern Recognition 36: 451-461. [crossref]
  10. Todri A, Papajorgji P, Moskowitz H, Scalera F (2020) Perceptions regarding distance learning in higher education, smoothing the transition. Contemporary Educational Technology 13: p.ep287.
  11. Berry DC, Michas IC, Gillie T, Forster M (1997) What do patients want to know about their medicines, and what do doctors want to tell them?: A comparative study. Psychology and Health 12: 467-480.
  12. Collins J, Farrall E, Turnbull DA, Hetzel DJ, Holtmann G, et al. (2009) Do we know what patients want? The doctor-patient communication gap in functional gastrointestinal disorders. Clinical Gastroenterology and Hepatology 7: 1252-1254. [crossref]
  13. Kay M, Mitchell G, Clavarino A (2010) What do doctors want? A consultation method when the patient is a doctor. Australian Journal of Primary Health 16: 52-59. [crossref]

A Brief Commentary on Improving the Quality of Healthcare Delivery Practices Using the Soft Skills of Communication

DOI: 10.31038/IJNM.2023442

 

“Communication is life and healthcare is where it begins”

The influence of rising fears and anxieties in healthcare and its impact on the shape of the future of educational curriculum cannot be ignored. We are experiencing a new epoch in which the concept of absolute truth is gradually becoming as subjective as our various individualist viewpoints. Now more than ever before there is a dire need for humanity to constructively address the various factors that may play minor or major roles in the influence of healthcare delivery. Cultural and behavioral viewpoints, as well as affinities are examples of such influences. It’s fair to mention that my previous message in a 2017 publication “The Patient in Room 1B: Confronting our Fears to Build Trust” was a peek into the future which has gradually unfolded to reveal the diverse aspects and challenges that are encountered in healthcare delivery practices across the nation.

Check out “Patient in Room 1B LinkedIn article:

https://bit.ly/3G0Gqy9

In recent years, the word “culture” has become more or less popular, depending on one’s perspective of its influence in healthcare and overall existence dispositions. In addition, the current world of pandemic and post pandemic infections have ushered in new approaches to clinical/ nursing education which not only address care management for acute illnesses but seek to uncover effective approaches for healthcare providers to efficiently manage patient diverse behaviors, attitudes, and rising fears/anxieties brought on by past and current life experiences and their impact on perceived economic and political atmosphere. The use of virtual healthcare technology has increasingly surged, and the expanded use of audio, video and other electronic communications devices has offered some much-needed relief from individuals’ anxieties and the pandemic stressors by enabling patients to easily and yet discreetly connect with their healthcare practitioners via mobile health apps, health information systems etc.

However, while these technological advancements are impressive, they are insufficient to address the unique approach to care delivery which explores the application of such disciplines as psychology and the observation of patient behavioral traits, cognitive biases, and the philosophy of language and its attempt to assist the patient achieve a healthy mental and physical balance. Patient’s distinct personalities, experiences, and backgrounds affect their outlook and mental status. Tailoring an individual care approach is necessary for optimal care delivery. There are lingering questions that continue to pervade various communities in an era where many people are not only dealing with the devastating effects of a pandemic, but also have differing perspectives on the best ways to help stabilize the country’s political, economic, educational, and health structures. As truth increasingly becomes as subjective as our diverse personal perceptions, active attempts to create a common understanding through deliberate interactive means are more important than ever. In recent times, many critical race theory arguments have erupted due to differing individual experiences and perspectives. Some suggest that students may experience feelings of discomfort, guilt, misery, or psychological stress because of a race-based curriculum while others refute such perspectives and emphasize the need for full disclosure of events of historical practices and events. Many more reveal that there are more progressive and uniting strategies to introduce students to knowledge that allows them to think critically about diversity, equality, and discrimination. There are claims that such an approach is undoubtedly possible when instructional materials are presented as human behavior and human attribute-based materials rather than race-based materials. In my earlier published book, “Tips For Effective Communication: A vital Tool for Trust Development in Healthcare” and my recent publication, “Think Communicate, Heal”, I discussed the most effective ways to attain educational success by implementing an educational curriculum that will aid in the expansion of clinical reasoning in order to close the gaps that have been identified in existing tangible educational formats. This will enable students in the healthcare industry to increase their perceptual grasp of clinical intuitions based on a variety of patient behaviors (other than race or ethnicity) to provide more efficient care. Unintended outcomes of educational tools that focus mainly on historical accounts of race and diversity may include growing reservations and a desire for vengeance across various communities. This defeats the goal of shining a good light on solidarity in the face of changing perspectives, ideas, and viewpoints. Due to underlying fears, a purposeful shift in attention to understanding human qualities and behaviors would be a more efficient technique for success in our educational institutions. This is because these human attributes are universal and occur across all diverse communities. There is no color to the human emotions or fears, anger, elation, feelings of exclusion or inclusion etc. More nursing/medical educational resources for expanding the reasoning to bridge the gaps noted in current forms of concrete educational formats are recommended. It will help practitioners and students improve their perceptual grasp of diverse clinical situations, to achieve a more trusting environment resulting in better efficiency for care delivery practices.

Nonye Tochi Aghanya is a Family Nurse Practitioner with current practice in retail clinic setting. She’s maintained interactions with patients in diverse healthcare settings for over 32 years. An author of various publications, more information about her work can be found on her website www.nonyetochi.com

Methods of Zootechnical Evaluation of the Queens

DOI: 10.31038/IJVB.2023713

 

In the genetic selection and improvement programs of the reproductive animals, an assessment must be made of the quantitative or measurable characteristics whose hereditary differences are transmitted from generation to generation by the same mechanisms of the genes responsible for the qualitative differences [1]. A reproductive animal can be evaluated through the analysis of several aspects: assessment of its genetic potential at the request of the qualities of its ancestors (pedigree), by that of its half-siblings (collaterals), by that of its descendants (testing), or through their own genetic material (studying their genome); and it can also be evaluated through its productive performance and its phenotype [2]. Despite the fact that honey bees were the first intensively breeding animals, after the silkworm Bombyx mori L [3] and that the first research carried out on intensive livestock farming was directed at beekeeping [4] there have not set criteria, patterns and parameters to describe the queens bees phenotype and neither the reproductive performance, as has been done in other livestock farms with their breeding animals. All of which bring about a great void in the queens evaluation. The races of bees have been differentiated based on biometric methods and behavioral characteristics [5]. Biometric measurements have to do with the width of the thorax and abdominal segments; the length of the tongue, legs and wings; the color of the first segment dorsal abdomen; the length of the tongue; the hairy covering and the wings nervation [6,7]. Thus we see that the biometric methods have an eminently entomological approach and basically oriented to the bee workers, not giving importance to the zootechnical-reproductive characteristics of queens. In the queens has been studied: the relationship of weight with the number of ovarioles [8]; how the fecundity of queens is influenced by their weight [9]; the relationship among the weight of the queens at birth with the number of ovarioles and the volume of the spermatheca [10]; how the selection for the width of the abdomen of the queens improves some production characteristics [11]; the correlation among the genetic and phenotype parameters and the weight, width and length of the abdomen [12]. From a zootechnical point of view, of queens in general it has only been said that those with large abdomen, rounded flanks that gradually thin out and have uniform color are good for laying eggs, although sometimes a queen with the characteristics described above is not necessarily a good egg-laying queen [13]. The criteria used to assess the behavioral characteristics of the queens are inferred from the behavior of the colonies (of their progeny) the ability to winter, the degree of docility, the tranquility on the combs when the hives are been inspecting, the non-willingness to swarm, or that if it is a good honey-producing colony queen [13]. There have been indicated of the queens imprecise aptitudes, such as: whether she has filled three or four combs with brood or whether the egg laying is concentric and concentrated and with brood of similar ages, she is a good queen; that if she is erratic in her movements it is not desirable; that if she lays continuously, producing brood through out the season and into late fall, she is a good queen [13]. Hence, the absence of criteria, patterns, parameters, indicators and zootechnical characteristics of phenotypic and reproductive value to evaluate queens creates a great void in the exploitation of bees as livestock animals. Consequently, it is necessary to establish practical and easy-to-apply zootechnical methods with the following objectives:

  1. Provide the beekeeper with some parameters and patterns that, at the time of the inspection of the hives, allow him to zootechnically describe the queens, in a technical, truthful and fast way; relying on the observation of its most outstanding phenotypical aspects.
  2. Make available a technique for quantifying the queen egg laying, based on biological criteria that are easy to understand and apply, with which the beekeeper can evaluate the reproductive behavior of queens within the conception of a farm animal.

References

  1. Shrode RR (1980) Sección IV. Herencia y mejora animal; La herencia y su forma de actuar. En, Curso de zootecnia, editorial Acribia. Zaragoza. España, pp. 253-358.
  2. Sañudo, C Sánchez, C Marcén JM (2009) Capítulo 8. Variación morfológica en bovino lechero. En, Valoración morfológica de los animales domésticos. Realización: SEZ. Coordinador: Carlos Sañudo Astiz. Edita Ministerio de Medio Ambiente y Medio Rural y Marino. Secretaría General Técnica. Centro de Publicaciones, pp. 235-269.
  3. Borror DJ Triplehorn, Ch.A Johnson NF (1989) An introduction to the study of insects. Sext Editions Saunders College Publishing. Harcourt Brace Jovanovich College Publishers. Printed in the United States of America. Library of Congress, pp. 588-664.
  4. Shrimpton DH (1970) Sección II. Especial. La investigación en relación con la ganadería intensiva. En, Zootecnia intensiva, editorial Acribia. Zaragoza. España, pp. 371-613.
  5. Ruttner, F (2015) Races of bees. In, The hive and the honey bee. Editorial Dadant & Sons. Inc, Hamilton, IL, (6234)1, USA, pp 47-70.
  6. Daly HV Balling SS (1978) Identification of africanized honey bees in the western hemisphere by discriminat analysis. Journal of the Kansas Entomological Society. 51(4): 857-869.
  7. Rinderer TE Sylvester HA Collins AM Pesante, D (1986) Identification of africanized and european honeybees: Effects of nurse bee genotype and comb size. Bulletin of the Entomological Society of America (32): 150-152.
  8. Hoopingarner, R Farrar CL (1959) Genetic control of size in queen honeybees Econ. Ent. 52: 547-548.
  9. Boch, R Jamieson CA (1960) Relation of body weight to fecundity in queen honeybees in The Canadian Entomol. V 92, 9: 700-701.
  10. Corbella, E Gonçalves LS (1982) Relationship between weight at emergence, number of ovarioles and spermathecal volume of Africanized honey bee queens (Apis mellifera). Rev. Bras. Genet 4, 835-840.
  11. Costa FM (2005) Estimativas de parâmetros genéticos e fenotípicos para peso e medidas morfométricas em rainhas Apis mellifera 39 f. Dissertação (Mestrado em Zootecnia)-Universidade Estadual de Maringá, Maringá.
  12. Halak AL 2012 Parámetros e correlacóes genéticas e fenotípicas para peso e medidas morfométricas em rainhas. Apis mellifera Dissertação apresentada, como parte das exigências para a obtenção do título de Mestre em Zootecnia, no Programa de Pós-Graduação em Zootecnia.
  13. Cale GH Sr Banker, R Powers, J 2015 Management of the hive for the production of honey. In, The hive and the honey bee, Editorial Dadant & Sons. Inc, Hamilton, IL, 62341, USA, pp. 463-531.

A Review on Antimicrobial Resistance of Bovine Salmonellosis and Its Public Health Importance: One Health Approach

DOI: 10.31038/IJVB.2023712

Abstract

Bovine Salmonellosis is the zoonotic disease caused by pathogenic Salmonella Species. The feco-oral route is the most important mode of transmission of Salmonellosis in animals. It is an important worldwide public health challenge causing substantial morbidity and has a significant economic loss. Human salmonellosis is mainly foodborne which is transmitted through consumption of contaminated food of animal origin which includes meat, milk, poultry meat and eggs. Some studies conducted in Ethiopia on prevalence of Salmonella provided that there were different levels of prevalence of disease in different parts of the country. Epidemiological pattern, prevalence and incidences of disease differ greatly between geographical areas. This is affected by pathogens themselves, industrialization, urbanization and change of lifestyles, knowledge, belief and practices of food handlers and consumers, demographic changes, international travel and migration, international trade in food, animal feed and poverty and lack of safe food preparation facilities. Having animals and raw products, it is not possible to be free from zoonotic agents like Salmonella; however the occurrences can be minimized by applying high standard of hygiene in all steps of food production. Some topics highlighted in this paper are the epidemiology, mode of transmission, treatment and control, public health importance, conclusion and recommendations.

Keywords

Antimicrobial Resistance, Food borne, Salmonella species, Zoonosis

Abbreviations

ARG: Antibiotic Resistance Gene; EU: European Union; FDA: Food and Drug Administration; HGT: Horizontal Gene Transfer; MRSA: Methicillin Resistance Staphylococcus aureus; NTS: Nontyphoid Salmonellosis; US: United State

Introduction

The genus Salmonella was named after Daniel E. Salmon first reported the isolation of Salmonella from a pig in 1885 and named the organism Bacterium choleraesuis. The bacterium is currently known as Salmonella enterica serovar Choleraesuis. Salmonella causes typhoid fever and gastroenteritis, and it is one of the major foodborne pathogens of significant public health concern in both developed and developing countries. Meat, poultry, eggs, nuts, fruits and vegetables, and humans are the major source of infection [1]. Salmonellae are common in cattle. They are often concern due to disease of cattle and the potential to infect human that come in contact with cattle or consume dairy product or bovine meat product. Meat processing and packaging at the whole sale or retail level contribute to higher levels of contamination in minced beef product compared to beef carcass. Bovine salmonelosis usually manifest clinically as a syndrome of septicemia, acute or chronic enteritis and abortion. There are few serotypes that are associated with cattle and of this Salmonella enterica serotype Dublin (S. dublin) and Salmonella enterica subspecies enterica serotype Typhimurium (S. typhimurium) is the most common. The presence of S. typhimurium in cattle and the cross contamination of beef carcass tissue is one of the most common cause of Salmonella infection in developed countries [2]. Bovine Salmonellosis causes gastro enteritis and typhoid fever and is one of the major foodborne pathogens of significant public health concern. Salmonellosis is a disease caused by many serotypes of Salmonella and characterized clinically by one or more of the three major syndromes; septicemia, acute and chronic enteritis. Salmonellae to be familiarized in the digestive system of humans and animals. Hence, the presence of Salmonellae in water, food, and environment is elucidated by fecal contamination [3]. There are more than 2500 serovars of Salmonella worldwide. In humans, Salmonella enterica typhi (S. typhi) and Salmonella enterica paratyphi (S. paratyphi) cause typhoid fever and paratyphoid fever, respectively. Animals and poultry are commonly infected with S. enteritidis and S. typhimurium that can be transmitted to human. Animal products including; poultry meat, eggs and milk, water, domestic and wild animals, rodents and pets have been implicated as important sources for human salmonellosis outbreaks [4]. Nontyphoidal Salmonella are most important zoonotic bacterial food-borne pathogens of humans. Salmonellae are widely distributed in nature, and they are the major pathogenic bacteria in humans as well as in animals. They are most frequently isolated bacterial agents of food-borne disease outbreaks, and they account around 93.8 million food-borne illnesses and 155,000 deaths per year worldwide [5]. Non-typhoid salmonellosis (NTS) sources are red meat, meat products, dairy products, vegetable origin, pet animals can harbor and shed Salmonella Serovars [6]. Bovine Salmonellosis in farm livestock and its association with human infection has attracted a great deal of attention, particularly in recent years. The appearance of a chloramphenicol resistant strain of Salmonella typhimurium phage type D T204 in calves in Great Britain highlighted the potential public health risks and since then chloramphenicol resistant strains of the same organism, thought to have in some cases been derived from calves, have been isolated from sick humans. More recently, chloramphenicol resistance has been demonstrated in other phage types of S. typhimurium and Salmonella dublin isolated from calves and other animals [7]. Bovine Salmonellosis is one of the most common foodborne diseases worldwide, accounting around 93.8 million foodborne illnesses and 155,000 deaths per year worldwide [8]. Reports in the United States account for more than one million people sickened by Salmonella each year from 2000 to 2008 give an estimated average cost in health care of this foodborne illness of $55.5 to $93.2 billion, in the United States. Reports from the EU in 2015 showed 94,625 confirmed cases of salmonellosis in humans and 126 deaths [9]. The prevalence of bovine salmonellosis in Ethiopia was 8.4% [3]. Bovine Salmonellosis is a major economically important public health issue. Globally, an estimation indicates 33 million cases, and 0.5 million deaths associated with typhoid fever while NTS cause 93 million illnesses with 0.155 million deaths each year [10]. Economic loss is due to investigation, treatment and prevention of illness [11] and also related to restriction of animal products from international trade (market). Therefore, the objective of this paper is to review the public health importance of bovine salmonellosis.

Bovine Salmonellosis

In cattle salmonellosis is primarily associated with two serotypes, the host-adapted S. dublin and the ubiquitous S. typhimurium, although other types are sometimes involved [12]. The incidence of the serotypes varies, but generally S. typhimurium is more common in adults and S. dublin in calves. The disease in adult cattle is usually sporadic, although S. dublin has become established in some areas of the country and on some farms, and acute and sub-acute forms of the disease are recognised [13]. Characteristically severe form of the disease produced by S. dublin in adult cattle, onset is usually sudden. Cattle suffer a high temperature, become dull and stop eating. Although their faeces are initially firm, severe diarrhoea often with blood soon develops. The high temperature usually persists form several days after which animals become cold and death may occur in up to 75% of untreated animals. With S. dublin this may result in pregnant cattle aborting, although abortion may also occur in the absence of any other signs. In some cattle the disease progresses more slowly and they become emaciated and dehydrated [14]. A similar disease is produced by other serotypes including S. typhimurium, although abortion is not as common. Survivors of S. dublin infection often remain as ‘carriers’, possibly for life, while the carrier state is rarer with other serotypes. The disease in calves usually occurs between two to six weeks of age, although animals may become infected soon after birth, or with S. dublin, may be born infected [15]. Characteristically, calves become dull, refuse to drink and develop a fever. Diarrhoea follows which in young calves involves the excretion of faeces with the colour and consistency of putty. It may be stained with blood and contain mucus. Eventually the faeces become dark brown and watery with an offensive odour, or may be very bloody. In older calves the faces is usually dark brown and watery. The disease is, however, very variable. Some calves become systemically infected and, especially those two to three days old, may collapse suddenly and die, even if treated. In other animals the disease is so mild as to pass unnoticed. Alternatively the diarrhoea is prolonged and they may eventually die of dehydration and loss of salts. Complications such as pneumonia, meningitis, arthritis and gangrene may occur. Mortality from acute salmonellosis in calves may be as high as 60% without treatment and all animals may become infected [16]. Bovine Salmonella is widespread and can be found on a large number of dairy farms and in many species of animals, including mammals, birds, insects, reptiles and humans. It is often an opportunistic bacterium, meaning it infects an animal when its immune system is suppressed, when other competing gut bacteria are absent (common after antibiotic therapy), or when the animal is very young. It also infects healthy animals when they are exposed to high doses. There are many Bovine Salmonella species that are able to infect cattle; some species are also able to infect man (referred to as zoonoses or zoonotic infections), and other farm animals such as dogs and cats. Salmonellosis is more severe in the very young and old in all animal species. Disease can be serious in those people with concurrent diseases and immuno-suppressant conditions. Infection can be acquired from contact with faeces, contaminated clothing, aborted material, and un-pasteurised milk. Salmonella species can cause a wide range of clinical signs in cattle including diarrhoea and possible dysentery, joint infections, chronic pneumonia, abortion and sudden death from septicaemia. An outbreak of salmonellosis can have serious economic consequences on a farm as well as public health implications [17]. Non-typhoidal Salmonella typically causes acute gastroenteritis resulting in diarrhoea, vomiting and abdominal pain, and occasionally more serious conditions such as septicaemia, meningitis and chronic arthritis, which require treatment with effective antibiotics. In addition to these human health impacts, Salmonella can also cause production losses in livestock systems. Animals typically contract Salmonella when they consume contaminated feed or water. All livestock species can be affected by salmonellosis with young, debilitated and parturient animals most susceptible to clinical disease. While research shows that a relatively high proportion of feed and water are contaminated with Salmonella, normal adult livestock can typically tolerate small numbers of the bacteria and avoid infection [18].

Public Health Importance of Bovine Salmonellosis

Bovine Salmonellosis is an important global public health problem causing substantial morbidity and thus also has a significant economic impact. Although most infections cause mild to moderate self-limited disease, serious infections leading to deaths do occur. In spite of the improvement in hygiene, food processing, education of food handlers and information to the consumers, foodborne diseases still dominate as the most important public health problem in most countries. Public health issues and the capability for foodborne zoonotic spread have made bovine Salmonellosis the focus of various international, national, and regional surveillance platforms [19]. Bovine Salmonellosis is a major and economically important public health issue. Globally, an estimation indicates 33 million cases, and 0.5 million deaths associated with typhoid fever, while NTS cause 93 million illnesses with 0.155 million deaths each year. Bovine Salmonellosis incidence is defined as the identification of Salmonella from animals or group of animal’s product or surrounding which can be specifically related to identifiable animals or from animals feed. On the human side, a registered medical practitioner in the US required under the Public Health (Control of Disease) act to notify the local authority, if the patient is suffering from or suspected of having foodborne disease. Studies provide increasing evidence of adverse human health consequences due to the occurrence of resistant microorganisms. Use of antimicrobial agents in human and animal affects the intestinal tract placing those concerned at increased risk of certain infection. This is defined as the proportion of Salmonella that would not have occurred if the Salmonella were not resistant. In addition antimicrobial agent used in animal can result in increased transmission of resistant microorganisms between animal and therefore would results in case of transmission of such microorganisms to human through food. Increased frequency of treatment failure and increase severity of infection may be manifested by prolonged duration of illness. Salmonella dublin is largely but not entirely specific to cattle with average 10 human case reported in each year in Ireland. Apart from its pathogenicity two other characteristics of S. dublin make it particularly important for Ireland from a public health viewpoints. First, it is very prevalent on Irish farms and secondly in evolutionary terms, it is only one step away from S. enteritidis, a common Salmonella serotype in poultry and the main case of clinical salmonellosis in humans [20]. In genetic terms, difference between the serovars S. dublin and S. enteritidis are no greater than those found within each serotypes. This indicates that, S. dublin and S. enteritidis share a common ancestor. One branch evolved in to a poultry adapted serotype capable of causing disease in human, the other in to host specific cattle pathogen. If S. dublin has been confirmed in breeding herd there is a significant risk of persistent infection in carrier cows for as long as animal which were present at the time of the outbreak remain in the herd [21].

Bovine Salmonellosis as a Food Born Disease

Bovine Salmonellosis is chiefly a foodborne infection and linked to the consumption of Salmonella-contaminated food products mostly from beef, poultry, pork and egg products. Humans, especially infected food handlers, and contaminated environments are also major reservoirs of Salmonella [22]. Human salmonellosis is generally foodborne and is contracted through consumption of contaminated food of animal origin such as meat, milk, poultry and eggs. Dairy products including cheese and ice cream were also implicated in the outbreak. However, fruits and vegetables such as lettuce, tomatoes, cilantro, alfalfa-sprouts and almonds have also been implicated in recent out-break [23]. Acute gastroenteritis is usually acquired from consumption of food which may be directly or indirectly contaminated with Salmonella [16]. Nontyphoidal Salmonella are most important zoonotic bacterial food-borne pathogens of humans. Salmonellae are widely distributed in nature and they are the major pathogenic bacteria in humans as well as in animals. they are most frequently isolated bacterial agents of food-borne disease outbreaks and they account around 93.8 million food-borne illnesses and 155,000 deaths per year worldwide. Salmonella has been found to be the major cause of food-borne diseases and a serious public health problem in the world, with an increasing concern for the emergence and spread of antimicrobial-resistant strains including in industrialized countries. Antibiotic-resistant Salmonella infections of both humans and animals are universal concerns, particularly in developing countries. Apart from the morbidity and mortality costs in humans and animals, restrictions to trade and discard contaminated food are important socioeconomic problems of the bacteria [5].

Antimicrobial Resistance

Antibiotics have consistently been viewed as one of the great revelations of the 20th century. The expansion in the use of antibiotics in emergency clinics, networks and the climate are increasing the antimicrobial resistance [24]. The misuse of microorganisms has resulted in the massive economical and financial losses, and enhanced the overall burden of diseases. Antimicrobial resistance of pathogenic microorganisms is a test related with high morbidity and mortality [25]. Antibiotics may be needed in high-risk groups, such as young children, the aged persons, and those with compromised immunity. With respect to the drugs, ampicillin, chloramphenicol, and trimethoprim sulfamethoxazole can be utilized for the treatment of Salmonellosis. However, resistance to these drugs has increased significantly in recent years. Fluoroquinolones have been recommended for the treatment of Salmonella infections for adults, while third generation cephalosporin are the drugs of choice to treat very young patients or when fluoroquinolone resistance is present (Tables 1 and 2) [26]. Multiple antimicrobial resistances (resistance to two or more antimicrobials). A total of seven different antimicrobial resistance patterns were observed.

Table 1: Antimicrobial Sensitivity Patterns for Salmonellae

Isolated from Infected Cattle*

Total

Resistant

Sensitive

Aureomycin R (30 mcg)

31

31

0

Kanamycin (30 mcg)

26

23

3

Neomycin (30 mcg)

26

23

3

Sulfonamides (1 mcg)

31

31

0

Streptomycin (10 mcg)

31

31

0

Chloramphenicol (30 mcg)

31

0

31

Naladixic Acid (30 mcg)

29

0

29

Polymyxin B (300 U)

31

0

31

Gentamicin (10 mcg_)

29

1

28

Furacin (Furadantin) Macrodantin (300 mcg)

31

0

31

Table 2: Antibiotic Susceptibility of Salmonella isolates in dairy farms

Antimicrobials Antibiotic Susceptibility profile

No.sensitive (%) No. intermediate (%) No. resistant (%)

Kanamycin 2 (7.1) 3 (10.7) 23 (82.1)

Nalidixic acid 0 (0.00) 7 (25.0) 21 (75.0)

Gentamicin 28 (100.0) 0 (0.00) 0 (0.00)

Cefoxitin 25 (89.3) 0 (0.00) 3 (10.7)

Streptomycin 16 (57.1) 9 (32.1) 3 (10.7)

Chloramphenicol 14 (50.0) 9 (32.1) 5 (17.9)

Tetracycline 0 (0.00) 1 (3.6) 27 (96.4)

Amoxicillin 10 (35.7) 11 (39.3) 7 (25.0)

Ampicillin 17 (60.7) 0 (0.00) 11 (39.3)

Ciprofloxacin 28 (100) 0 (0.00) 0 (0)

Trimethoprim 22 (78.6) 3 (10.7) 3 (10.7)

Sulfamethoxazol

Drug Resistance Development Impact

In Human Antibiotic resistance impact is a global phenomenon resulting in the emergence of pathogens with resistance to clinically important antibiotics, necessitating new treatment strategies. Antibiotic-resistant bacteria cause life-threatening illness in humans and pose a significant threat to health and well-being. It is estimated that antibiotic-resistant pathogens cause ~2 million illnesses and 23,000 deaths annually in the U.S. These illnesses cause an additional health care cost of $20 billion and a productivity loss of $35 billion to the U.S. economy. Also, extensive use of antibiotics predisposes individuals to other serious illnesses [24]. Antimicrobial resistance has led to the failure of treatment in 195,763 cases of pneumococcal disease and 2,925 child deaths annually in Ethiopia. It also resulted in a first-line treatment failure rate of 29.4%. Research has demonstrated that antimicrobial resistance is a significant threat to global public health. The long-term use of antibiotics in food animals creates ideal conditions for the development and spread of resistant strains [27]. Resistant bacteria in animals may directly or indirectly reach humans through food, water, mud, and manure, which are used as fertilizers. In fact, there is irrefutable evidence that foods from many animal sources and all food processing stages contain a large number of resistant bacteria. Homologous relationships between drug-resistant bacteria in humans and animals have been identified in the most common food-borne pathogens, such as E. coli and Salmonella, different types of enterococci, and methicillin-resistant Staphylococcus aureus (MRSA). Horizontal gene transfer (HGT) occurs between different bacterial species via mobile genetic elements such as plasmids, integrases, and transposases. Thus, HGT contributes significantly to the rapid spread of resistance. Farm and slaughterhouse workers, veterinarians, and those in close contact with farm workers are easily infected with resistant bacteria through daily exposure to infected animals [28]. Most of the infections caused by these NTS are self-limiting gastrointestinal disease with symptoms of diarrhoea, fever and abdominal cramps. Bacteremia and other extra intestinal focal manifestations usually do not result from mild forms of the disease. Antimicrobial treatment is reserved only in invasive infections, in immunosuppressed and in extremes of ages as antimicrobials can prolong the illness and excretion in Nontyphoidal Salmonellosis [18]. Commonly used drugs for the treatments are fluoroquinolones and extended spectrum cephalosporins. However there are reports of antimicrobial resistance among these Salmonella strains to different classes of antibiotics and that has left us with only few options for treatment. Multidrug resistant Nontyphoidal Salmonellosis has become a global concern now. Community and healthcare associated outbreaks have been reported all over the world due to these resistant strains. Development of antimicrobial resistance is a naturally occurring phenomenon and it is often enhanced by use of antimicrobial agents for the treatment and prevention of infections in humans and animals as well as addition of these antibiotics as growth promoters or for feed efficiency in the food of animals which has favoured the selection and transference of drug resistant strains of Salmonella [29]. In animal antibiotic resistance impact in foodborne pathogens such as Salmonella is a major concern for public health safety. More focus is required to target them in the animal foods supply. Salmonella is difficult to eliminate from its reservoir hosts, and food animals often serve as reservoirs of the pathogen [30]. Antimicrobials may increase the susceptibility of animals to infection by suppressing normal flora and increasing the probability that pathogens will colonize a site (the “competitive effect”) or, if administered at the time of exposure to a resistant pathogen, by facilitating the infection because of a selective effect (the “selective effect”) (see Barza and Travers, this supplement). Resistant nosocomial salmonellosis attributable to antimicrobial therapy occurs in cattle, horses, cats, and probably other species, although little is published on this subject. Between 3% and 26% of resistant Salmonella infections of humans are acquired through a selective mechanism associated with antimicrobial treatments, according to Barza and Travers (this supplement). Comparable estimates for animals remain to be determined. Antimicrobials may prolong shedding or elevate levels of antimicrobial resistant pathogens in feces [28]. In its Framework document, the FDA states a concern about antimicrobial use in food animals increasing the pathogen load in an animal’s intestinal tract, which could increase infection risks for consumers. When challenged with Salmonella and exposed to antimicrobials in feed. Drug resistance development impact in the environment is one of the most noted consequences of antibiotic misuse and antibiotic pollution is the increased frequency of bacteria harboring ARGs in di_erent environments (here, antibiotic resistance is defined as any reduction in susceptibility in a bacterial strain compared to the susceptible wild type . An increase of antibiotic-resistance genes has also been observed in environmental. For example, ARG abundance for all classes of antibiotics was found to be significantly increased in soils from the Netherlands since the 1940s [31]. Resistance to antibiotics can be conveyed via a broad range of mechanisms. For example, antibiotics can be inactivated (e.g., beta-lactamases cleaving beta-lactams such as penicillin) or transported outside of the bacterial cell via e_ux pumps (e.g., Tet A proteins pumping tetracyclines outside of cells). The modification of the antibiotic’s target (e.g., point mutations in gyr A prevent binding by ciprofloxacin) is another common mechanism [32]. The prevalence of nosocomial (hospital-acquired) infections with resistant bacteria make hospitals and extended care facilities high interest environments to study the evolution and dissemination of antibiotic resistance. The microbial communities mostly associated with ARGs in hospitals are members of various human microbiomes as well as situated in hospital water and air flow systems [33]. Hospitals employ a broad range of antibiotics over extended time spans, thus enabling de novo resistance evolution, for example during long-term treatment of chronic infections. Environmental contamination and wildlife may also play a role in bovine S. typhimurium infection. Grazing cattle often obtain drinking water from streams and rivers which may receive effluent from sewage and meat processing plants. Streams and rivers can be a source of infection [31].

Transmission Modes

Bovine salmonellosis is spread by direct or indirect means. Infected animals are the source of the organisms; they excrete them and infect other animals, directly or indirectly by contamination of the environment, primarily feed and water supplies [34]. The farm animal may be infected in different ways: by animal-to-animal transmission, especially of host-adapted serovars; by contaminated animal feed; and by a contaminated environment (soil, birds, rodents, insects, water supplies). The excretion of salmonellas is exacerbated by the stress imposed [35]. Transmission of Salmonella to humans traditionally has been attributed to contaminated animal-product foods, but epidemiological studies have demonstrated that cases are sporadic and may more likely involve environmental sources than previously thought. It has been suggested that contaminated soils, sediments and water as well as wildlife may play a significant role in Salmonella transmission. Consumption of raw milk, inadequately pasteurized milk, improperly cooked beef from culled dairy cattle, contaminated water and direct animal contact are the major routes of acquiring dairy associated salmonellosis in humans [25]. Most Salmonella infection in farm animals are likely to acquire from animals of the same species, especially in the case of the host adapted serovars. In adult cattle there are important differences in the behavior of S. Dublin and S. typhimurium. Those animals which recover from S. dublin infection may become persistent excreters, shedding up to 106 organisms per gram of feaces daily. Other herd may harbor infection and excrete the organisms only when stressed particularly at parturition [19]. Aerosol transmission has long been suggested as a means by which Salmonella may be transmitted and experimental infection of calves by aerosol has been reported recently. In addition pasture contamination results when flooding occurs and there are many reports clinical case in adult cattle arising from grazing recently flooded pasture [2]. A wide variety of animal species have been shown to be capable of harboring the organisms and in the developed world turkey, chicken, swine and cattle are found to be infected carriers in the studies conducted in the abattoirs. These carriers may readily shed Salmonella during transportation to the abattoir and contaminate abattoir workers or equipment during slaughter. The progressive trend forwards mass processing and distribution of food products has been an important factor in the increase incidences of Salmonella foodborne diseases. Person to person spread has been demonstrated on many occasions and may take place in young children and group living under poor socioeconomic condition where effective sanitation is lacking. Person to person spread also may occur in hospitals, nursing homes, mental institution in which large number of outbreak has occurred [5]. Amplification of infection in these institutions may occur from contaminated food or asymptomatic carrier’s babies being at special risk [36]. Direct or indirect contact with animals colonized with Salmonella is another source of infection, including contact during visits to petting zoos and farms Fecal oral route and vehicle born infection may result from ingestion of food or water that have been contaminated with human or animal feaces or from direct exposure to animals or their waste. A lower infectious dose of organism is usually required in the elderly, the immunocompromised, antibiotic users and those with a chlorhydria or regular use of antacid and related medication [37]. The commonly recognized vehicle of transmission includes inadequate cooked or raw meat, unpasteurized milk or milk product, contaminated and inadequately treated drinking water [20]. Contamination of milk may occur by a variety of route. Animal may occasionally, excrete the organisms in milk during the febrile stage of the disease or more likely infected feaces, from either a clinically infected cow or healthy carrier may contaminate the milk during the milking process. Milk also may be contaminated from use of polluted water from dirty equipment or from dairy workers. Indirect contamination also has been described when cattle have become contaminated with Salmonella. Contamination of food also may occur directly from Salmonella infected food handlers or indirectly from sewage polluted water (Figure 1) [36].

fig 1

Figure 1: Transmission modes

Potential Risk Factors

Proximity to animals, food consumption behavidor, problems related to contamination of milk and meat, inadequate supply of treatment drugs, harsh environment (hot, dry and dusty zones), and socio economic and cultural practices are the main factors that expose the pastoralists to different zoonotic diseases [38]. Human behavior and level of education are further factors that may influence health status Migration may put nomadic pastoralists at periodical risk of infection, especially around water point. Since the animal and human interface is very intimate and common event in the pastoral areas of Ethiopia, it is very difficult to address the health of animals and humans separately but better if integrated. The pastoral area of Ethiopia is characterized by large size, limited development and inadequate supply of health care materials. The human population tends to be small, highly mobile, and difficult to reach, and derive their food and income from their livestock. The main concerns of the pastoral people are livestock diseases and water supply which contributed to the occurrence of different infectious diseases (Abebe, 2003).

Animal Risk Factors

The clinical characteristics of salmonellosis in large animals vary depending on the various management systems used, the intensity of stocking, whether or not the animals are housed, and the epidemiological characteristics of the different Salmonella species. The response to infection with a Salmonella sp. varies depending on the size of the challenge dose and the immunological status of the animal, itself dependent on colostrum intake in neonates, previous exposure to infection and exposure to stressors, particularly in older animals [39].

Environmental and Management risk Factors

Intensification of husbandry in all species is recognized as a factor contributing significantly to an increase in the new infection rate. Any significant change in management of the herd or a group of animals can precipitate the onset of clinical salmonellosis if the infection preexists in those animals. Temperature and wetness are most important, as salmonellas are susceptible to drying and sunlight [33].

Pathogen Risk Factors

Salmonellas are facultative intracellular organisms that survive in the phagolysosome of macrophages and can therefore evade the bactericidal effect of antibody. Compared to other organisms of the same family, salmonellas are relatively resistant to various environmental factors. They multiply at temperatures between 8°C and 45°C, at water activities above 0.94, and in a pH range of 4-8. They are also able to multiply in an environment with a low level of or no oxygen [40].

Human Source

The environmental and personal hygiene is one of the knowledge and practice restrictions of human from beef/dairy farm and abattoir food processing plants [41]. On the other hand food getting contamination depends largely on the health status of the food handlers. Food borne diseases are a public health problem in developed and developing countries like Ethiopia, the contamination occurs at any point during its journey through production, processing, distribution, and preparation. High standards of hygiene of personnel are required to maintain in food processing industries and dairy farms [8].

The host adapted serovars (some of which are human pathogens and may be contracted from foods): included are S. Gallinarum (poultry), S. Dublin (cattle), S. Abortusovis (sheep) and S. Choleraesuis (swine). Unadapted serovars (no host preference). These are pathogenic for humans and other animals, and they include most foodborne serova [42]. The Host-specific Salmonella serovars and the diseases, disease symptoms and pathological effects see on table 3 below (Table 3).

Table 3: Salmonella serovars, diseases, symptoms and pathological effects

Serovars

Host

Disease, symptoms, pathological lesions

S. Typhi

S. Paratyphi A, B, C

S. Dublin

S. Choleraesuis

S. Pullorum

S. Gallinarum

S. Abortusequi

S. Abortusovis

Humans

Cattle and calves

Pigs

Chickens, turkeys

Chickens, turkeys

Horses

Sheep

Typhoid fever, paratyphoid fever

Cattle: diarrhea, fever necrotic enteritis

Calves: diarrhea, fever, enteritis

Septicaemia, pneumonia, hepatitis

Pullorum disease

Fowl typhoid

Abortion

Abortion

Status of Bovine Salmonellosis in Ethiopia

Status of Bovine Salmonellosis in Ethiopia from (2003-2017) Food borne diseases are public health problems both in developed and developing countries. Thousands of millions of people fall ill and may die as a result of eating unsafe foods. Biological contaminants largely bacteria, constitute the major cause of food borne diseases. Salmonella infection most commonly occurs in countries with poor standards of hygiene in food preparation and handling and where sanitary disposal of sewage is lacking [43]. Studies indicated the widespread occurrence and distribution of Salmonella in Ethiopia. In Ethiopia, minced beef is usually used for the preparation of a popular traditional Ethiopian dish known as locally “Kitfo” and most of the time it is consumed raw or medium cooked. The habit of raw meat consumption and the presence of Salmonella in minced beef indicate, in addition to the poor hygienic standards in food handling in the country, the presence of great public health hazards of Salmonella. A number of studies conducted by different individuals on various slaughtered beef animals and foods of beef origin are showed the prevalence of Salmonella in the country as indicated in the Table 4 below.

Table 4: Prevalence of Bovine Salmonellosis in different parts of Ethiopia from 2003-2017

Area

Species

Sample type

Prevalence

Year

Addis Ababa and Modjo Sheep and goats Faeces, mesenteri lymph nodes, liver, spleen, and abdominal and diaphragmatic muscle

1.80%

2003/2004

Modjo Sheep and goats Skin swabs, mesenteric lymph nodes, hand swabs, caecal contents, knife swabs, carcass and water

8.90%

2007/2008

Addis Ababa Cattle Faecal and milk

10.76%

2010

Addis Ababa Abattoir enterprise Sheep and goats Liver, kidney, spleen, muscle, carcass, mesenteric lymph node and feces

1.04%

2010-2011

Gondar Cattle Raw meat and swab

17.30%

2013

Holeta Cattle Rectal feces, udder milk, pooled milkers, hand swab, tank milk, tank swabs, and bucket swabs

5.60%

2014

Asella Cattle Carcass swab, Hanging material swab, Knife swab, Hand swab, lymph node, Faeces, milk

6.50%

2014

Gondar Animal-origin food items Raw meat, minced meat, burger, raw eggs, and raw milk.

5.50%

2014-2015

Eastern Hararghe Sheep Faeces

6.19%

2014/2015

Addis Ababa Cattle Fecal and carcass swab

3.70%

2014/2015

Dessie Cattle Meat, eviscerating knives and

4.95%

2014/2015

Bahir Dar Cattle Meat

70%

2015

Modjo and Bishoftu Sheep and goats Cecum, liver, mesenteric lymph nodes, abdominal muscle

17.21%

2015/2016

Eastern Haraghe Cattle, sheep and goats Faeces

5.07%

2015/2016

Holeta Dogs Rectal Swab

17.10%

2015/2016

Ambo Cattle Mesenteric lymph nodes and feces

8%

2015/2016

Wolaita Sodo Cattle Abdomen, thorax, crutch, and breast

12.50%

2015/2016

Addis Ababa Cattle Feces, carcass swabs, milk

7.50%

2017

Economic Importance

Bovine Salmonellosis is a significant cause of economic loss in farm animals because of the cost of clinical disease, which include death, diagnosis and treatment of clinical cases, diagnostic laboratory cost, the cost of cleaning and disinfection and cost of control and prevention [17]. In addition when the disease is diagnosed in the herd, it can create a considerable apprehension in the producer because of difficulty on identifying infected animals. An estimation of economic impact of an outbreak of S. Dublin infection in calf rearing unit indicate that the cost of disease represented a substantial proportion of gross margin of rearing calves [9]. Estimated annual costs for salmonellosis have ranged from billions of dollars in United States to hundreds to millions of dollars in Canada and millions of pounds in United Kingdom. Analysis of five Salmonella outbreak due to manufactured food in North America gave direct cost with range from $36,400-$62 million, there have been few studies in to the cost and benefit of preventing Salmonella infection, but it has been suggested that for every £1 spent on investigation and curtailment of the outbreak there is a saving of £5 [2]. Both clinical outbreaks and subclinical infections of Salmonella can drain profit from the dairy operation. Salmonella infection in a dairy herd can lead to losses from: milk production decline, death in any age group of livestock, abortions, treatment costs, losses from antibiotic, contaminated milk, increased culling, increased cost due to delayed culling while antibiotic residues clear, increased labor for management of sick animals, reduced feed efficiency, the inability to sell animals originating from an “infected” herd. Salmonella infection in a herd is also a significant public health risk to farm families, employees and visitors. This disease has serious economic, animal health and public health implications. Your veterinarian should become involved as soon as Salmonella is suspected [17]. Costs of animal diseases are normally associated with reductions in animal populations and production. There are also costs related to the mitigation of disease, which include the money and resources expended to monitor, control and, in extreme cases, eliminate the disease agent. Animal diseases that reduce reproductive competence increase the proportion of breeding animals that have to be maintained and thereby reduce the overall efficiency of the population [44]. In a recent edition of the Morbidity and Mortality Weekly reported at the 2018. FoodNet findings citing 25,606 laboratory-confirmed cases of foodborne illness, which led to the hospitalization of 5,893 individuals and 120 deaths. In the 2018 FoodNet data, Salmonella was the second most commonly reported pathogen with 9,084 cases of illness (18.3 cases per 100,000 individuals). The most commonly reported Salmonella serotypes by case were Salmonella serotype Enteritidis (S. Enteritidis: 2.6 per 100,000 individuals), Salmonella serotype Newport (S. Newport: 1.6), and Salmonella serotype Typhimurium (S. Typhimurium) [12].

Conclusion and Recommendation

Bovine Salmonella is a leading cause of foodborne disease in human and consumption of both meat and milk has been implicated in salmonellosis outbreaks of people. Having animals and raw products it is not possible to be free from zoonotic agent; however the occurrences can be minimized by applying high standard of hygiene in all steps of the food production. Infected animals can present with a great variety of clinical symptoms, and risk factors for transmission to humans clearly differ by animal species, age groups, animal purpose and geographic region. In addition, strains of Salmonella resistant to multiple antibiotics have been isolated from dairy cow during salmonellosis outbreak on dairy operation. The same strains have also been isolated from ill people. A high degree of interaction between medical and veterinarian surveillance is needed. Finally, implementing basic and applied research to the agent that cause foodborne salmonellosis will be a crucial point for new approaches to prevent and control the disease. Based on the above facts the following recommendations are forwarded: Strict hygiene of the slaughter house and lairage, People should not drink unpasteurized milk or milk products and should not eat raw meat, Education of food handlers, Vaccination of cattle, Maintenance of cold chains, Setting import standards, Sanitary examination of the product, Collaboration between government agencies, professional organizations and special interest groups.

Acknowledgements

Above all, I would like to praise my Almighty God, for supporting me health wisdom and strength in my work and for his perfect protection and guidance of my life. I would like to express great thanks for my parents for their great consolidation and financial support to educate me and my advisor Dr. Bayan Ahmed for his active gueding and advising me in working this manuscript. Finally, I greatly acknowledge to Haramaya University library workers for supporting me internet service that helps me to get different data sources.

References

  1. Bhunia AK (2018) Foodborne Microbial Pathogens.
  2. Kemal J (2014) Journal of Veterinary Science & A Review on the Public Health Importance of Bovine Salmonellosis. 5(2) https://doi.org/10.4172/2157-7579.1000175.
  3. Kahsay AG (2020) Prevalence and antimicrobial resistance of animal Salmonellosis in Ethiopia Overview of Salmonellosis. 1-17.
  4. El-Ghany WAA (2006) Salmonellosis : A food borne zoonotic and public health disease in Egypt. 10-14. https://doi.org/10.3855/jidc.12739
  5. Abebe E, Gugsa G, Ahmed M (2020) Review on Major Food-Borne Zoonotic Bacterial Pathogens. 2020.
  6. Adem J, Bushra E (2016) Bovine Salmonellosis and Its Public Health Importance : A Review. 62-71.
  7. Williams BM, Med, BV (2010) Bovine Sal monellosis. 15.
  8. Cavallo SJ et al. (2015) Human outbreak of Salmonella typhimurium associated with exposure to locally made chicken jerky pet treats, New Hampshire, 2013. Foodborne Pathogens and Disease 12: 441-446. 2015.
  9. Adem J, Bushra E (2016) Bovine Salmonellosis and Its Public Health Importance : A Review. 62-71.
  10. Younus M, Idrees, M. A, Akram Q, Ahmad W, Sciences A, Sciences A, Sciences A, Significance, P. H (2021) Pathology and public health significance of salmonella.
  11. Eduardo S, Monroy A (2000) Salmonella in Domestic Animals.
  12. Jones P (2000) Living With Bovine Salmonellosis. 2(3), 1-8.
  13. Williams, B. M, Med, B. V (2010) Bovine Sal monellosis. 15.
  14. Industry B, Safety F (2020) Salmonella White Paper. January.
  15. Rohr, J. R, Barrett, C. B, Civitello, D. J, Craft, M. E, Delius B, Deleo, G. A, Hudson, P. J, Jouanard N, Nguyen, K. H, Ostfeld, R. S, Remais, J. V, Riveau G, Sokolow, S. H, Tilman D (2019) to global food production. Nature Sustainability, 2(June), 445-456. https://doi.org/10.1038/s41893-019-0293-3
  16. Safety F, Practices, F. H (2021) Salmonella , Food Safety and Food Handling Practices. 1-16.
  17. Majowicz, S. E, Musto J, Scallan E, Angulo, F. J, Kirk M, Brien, S. J. O, Jones, T. F, Fazil A, Hoekstra, R. M, Collaboration I, Burden D (2010) The Global Burden of Nontyphoidal Salmonella Gastroenteritis. 50, 882-889. https://doi.org/10.1086/650733
  18. Hoelzer K, Isabel A, Switt M, Wiedmann M (2011) Animal contact as a source of human non-typhoidal salmonellosis. 1-28.
  19. Pal M, Teashal, B. M, Gizaw F, Alemayehu G, Kandi V (2020) Animals and Food of Animal Origin as a Potential Source of Salmonellosis : A Review of the Epidemiology , Laboratory Diagnosis , Economic Impact and Public Health Significance. 8(2), 48-56. https://doi.org/10.12691/ajmr-8-2-2.
  20. Zekarias T, Mandado T (2020) Public Health Importance of Bovine Salmonellosis in Ethiopia : A Review. 22(1), 1-8. https://doi.org/10.5829/idosi.gv.2020.01.08
  21. Johnson, T. J, Wannemuehler, Y. M, Johnson, S. J, Logue, C. M, White, D. G, Doetkott C, Nolan, L. K (2007) Plasmid replicon typing of commensal and pathogenic Escherichia coli isolates. Applied and Environmental Microbiology, 73(6), 1976-1983. https://doi.org/10.1128/AEM.02171-06
  22. Heredia N, García S (2018) Animals as sources of food-borne pathogens : A review. Animal Nutrition, 4(3), 250-255. https://doi.org/10.1016/j.aninu.2018.04.006
  23. Muktar Y, Abera G, Kemal J, Medicine V, Box, P. O, Dawa D (2015) Antibiotic Resistance in Salmonella Species , a Serious Public Health Problem : A Review. 15(5), 469-479. https://doi.org/10.5829/idosi.gv.2015.15.05.96225
  24. Sahoo, K. C, Tamhankar, A. J, Johansson E, Lundborg, C. S (2010) Antibiotic use , resistance development and environmental factors : a qualitative study among healthcare professionals in Orissa , India.
  25. Molossi, F. A, Lorenzett, M. P, , Sonne L, Driemeier D (2021) Epidemiological and pathological aspects of salmonellosis in cattle in southern Brazil.
  26. AC F (2005) Towards more virulent and antibiotic-resistant Salmonella ? FEMS Immunol Med Microbiol 43:1-11.
  27. Nair, D. V. T, Venkitanarayanan K, Johny, A. K (2018) Antibiotic-Resistant Salmonella in the Food Supply and the Potential Role of Antibiotic Alternatives for Control. https://doi.org/10.3390/foods7100167
  28. Casarin, R. A (2018) Antimicrobial Resistance : Its Surveillance , Impact , and Alternative Management Strategies in Dairy Animals. 4(January), 1-27. https://doi.org/10.3389/fvets.2017.00237
  29. Article R (2017) Drug Resistance in Nontyphoidal Salmonella- Challenges for the Future. 6-11.
  30. Mcewen, S. A, Fedorka-cray, P. J (2002) Antimicrobial Use and Resistance in Animals. 34(Suppl 3), 93-106.
  31. Kraemer, S. A, Ramachandran A, Perron, G. G (2019) Antibiotic Pollution in the Environment : From Microbial Ecology to Public Policy. 1-24.
  32. Review S, Ramatla T, Tawana M, Onyiche, T. E, Lekota, K. E, Thekisoe O (2021) Prevalence of Antibiotic Resistance in Salmonella Serotypes Concurrently Isolated from the Environment , Animals , and Humans in South Africa : A Systematic Review and.
  33. Agency, U. S, Development I (2019) Livestock growth, public health and the environment.
  34. States U, States U (2013) Signs and Symptoms Diagnosis Treatment Transmission. 2011-2013.
  35. Kachni, J. Č, Sasáková N, Papajová I, Ová, K. V. L. Č, Hromada R (2013) The risk to human health related to disposal of animal wastes to soil – microbiological and parasitical aspects. 147-154. https://doi.org/10.2478/s11687-013-0124-4.
  36. Barrow P.A, Jones MA, T. N (2010) Pathogenesis of bacterial infection in animals 4th edition. Edited by Gyles, C.L, Songer, G. Theon, C.O: Blackwell publishing 233. 2010.
  37. Orriss, G. D (1997) Animal Diseases of Public Health Importance. 3(4), 497-502.
  38. Takele S, Woldemichael K, Gashaw, M., Tassew H, Yohannes M, Abdissa A (2018) Prevalence and drug susceptibility pattern of Salmonella isolates from apparently healthy slaughter cattle and personnel working at the Jimma municipal abattoir ,. 1-7.
  39. Mcdaniel, C. J, Cardwell, D. M, Moeller, R. B, Gray, G. C (2014) Humans and Cattle : A Review of Bovine Zoonoses. 14(1) https://doi.org/10.1089/vbz.2012.1164
  40. Jajere, S. M (2019) A review of Salmonella enterica with particular focus on the pathogenicity and virulence factors, host specificity and antimicrobial resistance including multidrug resistance. Vet World. 12, 2019.
  41. CDC (2014) Control and Prevention, Eight multistate outbreaks of human Salmonella infections linked to small turtles (final update)
  42. DSM (2009) Diagnostic Services of Manitoba (DSM) (2009): Salmonella Nomenclature and the Reporting of Results on Salmonella Species: Memorandum. 2009.
  43. Husbandry A (2020) Salmonella and Its Status in Ethiopia. 7(1)
  44. Federation I, Health A (2012) The Costs of Animal Disease. October.

Rethinking Assessment: Advancing Equity and Learning in Education: A Critical Analysis of “Ungrading: The Case for Abandoning Institutionalized Assessment Protocols and Improving Pedagogical Strategies”

DOI: 10.31038/PSYJ.2023574

Introduction

As the corresponding author of the article titled “Ungrading: The Case for Abandoning Institutionalized Assessment Protocols and Improving Pedagogical Strategies,” published in Educational Science, I would like to provide a comprehensive commentary on our work. It scrutinizes the flaws in our current assessment practices and proposes innovative approaches that promise a more inclusive, dynamic, and adaptable educational experience [1]. This commentary aims to shed light on the key points, methods, and implications of our study while offering insights into its significance and areas for further research.

Summary

In our article, we challenge the conventional grading systems prevalent in education and advocate for a paradigm shift towards assessing students based on improvement scores [1]. To demonstrate the effectiveness of this approach, we conducted a pilot study involving 40 students in a general physics class at a local Californian university. Our study primarily focuses on a Hispanic-descendant student group, with an average age of 22.5 years and a predominantly male composition. We administered both pre-test and post-test assessments, specifically the Force Concept Inventory (FCI), to establish a baseline understanding of force concepts and to gauge the impact of our instructional sessions on force. We subsequently calculated improvement scores for each student and converted them into a 0 to 30 grading scale using a modified formula that considers difficulty scores. Our findings indicated significant differences between baseline, actual, and new test scores, with the latter two demonstrating higher mean performance [1].

Critical Analysis

Strengths

  • Innovative Approach: Our article presents an innovative approach to grading that prioritizes individual student progress, fostering a growth mindset and reducing competition.
  • Inclusion of Difficulty Score: By incorporating a difficulty score into our grading formula, we introduce a nuanced perspective that acknowledges the influence of test difficulty on student performance.
  • Emphasis on Individual Growth: We emphasize the importance of recognizing and celebrating students’ individual growth, which has the potential to create a more positive learning environment.
  • Integrating Technology: The article introduces the concept of using AI-powered adaptive learning tools to enhance the learning experience and address diverse learning needs.

Weaknesses

  • Limited Sample Size: We acknowledge the limitation of a relatively small sample size, which may affect the generalizability of our findings to a broader student population.
  • Short-Term Focus: Our study primarily focuses on short-term improvements within a single semester, and further research is needed to assess the long-term effects of our proposed grading changes.
  • Potential for Bias: Despite our efforts to address bias, the modified grading formula may still introduce bias, potentially impacting the fairness of the grading system.

Engage with the Content

As the corresponding author, I fully endorse the argument presented in our article. Traditional grading systems often create unnecessary competition among students and do not adequately recognize individual growth. Shifting the focus to improvement scores aligns with our commitment to promoting a growth mindset and reducing student anxiety [1]. The insights from the use of technologies, the article reinforce the importance of using a variety of assessment methods to understand students’ prior knowledge and address misconceptions. The proposed hyperflex learning strategy, personalized learning, combining one-on-one peer interaction and self-paced online learning, presents an inclusive approach to supporting students with diverse learning paces. This strategy, enhanced by AI tools, offers a promising way to cater to individual needs effectively. However, I also recognize the limitations of our study, including the small sample size and the need for long-term assessment. These limitations provide valuable insights for future research, which should aim to address these issues and refine our proposed grading approach.

Implications and Significance

Our article’s emphasis on improvement scores has the potential to revolutionize educational practices, fostering a more inclusive learning environment and empowering students to take ownership of their progress. Recognizing individual growth and eliminating unnecessary competition are significant contributions to the field of education. The use of AI-powered adaptive learning tools, as highlighted in the section on new ideas, offers personalized learning experiences that can address individual student needs, identify challenges, and provide timely interventions. The reward system and the emphasis on questioning techniques further contribute to making learning more accessible, experiential, and equitable [1]. By considering these innovative ideas and incorporating AI tools, educators can create adaptable and inclusive learning environments that empower students to take ownership of their education and foster essential skills for lifelong learning.

Conclusion

Our article, “Ungrading: The Case for Abandoning Institutionalized Assessment Protocols and Improving Pedagogical Strategies,” offers an innovative perspective on grading. These methods foster student ownership of education, encourage active participation in their learning journey, and equip them with the skills and knowledge needed for lifelong success. While it has strengths in promoting a positive learning environment and recognizing individual growth, we acknowledge its limitations. We encourage further research to refine and validate the proposed grading approach, emphasizing the importance of ongoing dialogue about effective teaching and learning strategies.

References

  1. Crogman HT, Eshun KO, Jackson M, Trebeau Crogman MA, Joseph E, et al. (2023) Ungrading: The Case for Abandoning Institutionalized Assessment Protocols and Improving Pedagogical Strategies. Education Sciences 13: 1091.

Plasticity of Pancreatic Acinar Cells-Lesson from Hpa2- KO Mice

DOI: 10.31038/CST.2023834

 

The pancreas is made predominantly of acinar (exocrine aspect) and duct cells, while the islet cells (endocrine aspect) make up to 2% of the pancreas. Importantly, these cell types display remarkable plasticity and can alter cellular identity in response to injury, regeneration, and repair [1]. With the limitations due to ethical issues, much of our understanding of genes and molecular pathways that modulate the development, differentiation, and homeostasis of the pancreas originates from animal studies. Utilizing a newly developed conditional knockout (KO) mouse model, Kayal et al have recently reported that heparanase-2 (Hpa2) plays a critical role in acinar cell differentiation and protects the pancreas from malignant transformation and inflammation [2]. Heparanase is a unique enzyme due to its endoglycosidase activity, capable of cleaving heparan sulfate (HS) side chains of heparan sulfate proteoglycans (HSPG). HSPG are highly abundant in the extracellular matrix (ECM) and assist in assembling the major protein constituents of the ECM and basement membrane (i.e., laminin, fibronectin, collagen IV) into a three-dimensional, non-soluble matrix that provides structural support and biochemical cues to many cell types. Cleavage of HS by heparanase thus results in remodeling of the ECM, which in the pancreas results in impaired islet β cell survival [3]. These structural and biochemical alterations exert a profound impact on cell behavior including, among others, cell viability, differentiation, proliferation, migration and invasion. The latter is most often associated with increased metastatic capacity of tumor cells and augmented entry of immune cells into sites of inflammation. This, and many other mechanisms utilized by heparanase to promote tumorigenesis, have turned this enzyme into a promising drug target and heparanase inhibitors are currently being evaluated in clinical trials as anti-cancer drugs [4,5]. HPSE2, the gene encoding heparanase-2 (Hpa2), was cloned soon after the cloning of heparanase, based on sequence homology. Interestingly, Hpa2 lacks intrinsic HS-degrading activity, the hallmark of heparanase, yet retains the capacity to bind HS with high affinity, thereby competing for HS and inhibiting heparanase enzymatic activity capacity. Unlike the intense research effort devoted to exploring the significance of heparanase in cancer progression, very little attention was given to Hpa2. The emerging role of Hpa2 in autosomal recessive congenital disease called urofacial syndrome (UFS) [6,7], clearly indicates that Hpa2 plays a critical role in human disorders. To further explore the role of Hpa2 in tumorigenesis, Kayal et al generated a conditional Hpa2-knockout (KO) mouse. Interestingly, it was observed that the pancreas of Hpa2-KO female mice is smaller, presenting half the weight of wild-type pancreas when calculated relative to body weight. Importantly, heparanase enzymatic activity was dramatically increased in pancreatic tissue derived from Hpa2-KO mice vs. control, wt mice. Histological examination revealed significant morphological abnormalities in Hpa2-KO vs. wt pancreas. A large proportion of the Hpa2-KO pancreas appeared to consist of fat cells, replacing the pancreas acinar cells (Figure 1), possibly the result of acinar-to-adipocyte transdifferentiation (AAT) [8]. In addition, a substantial number of duct-like structures were observed only within the Hpa2-KO pancreas. These were stained positive for cytokeratin 19 and Sox 9 and exhibited high proliferative capacity. In addition, these structures deposited large amounts of collagen and were stained strongly with alcian blue that labels HS. Altogether, indicating that the Hpa2-KO pancreas undergoes acinar-to-ductal metaplasia (ADM) [9] and turns into fatty tissue. Fatty pancreas was first observed in the 1930s by imaging studies performed for other indications; it was thought to be an incidental finding and its clinical implications were not thoroughly investigated. In recent years, however, there has been accumulating evidence supporting the association of fatty pancreas with the development of pancreatic cancer as well as other pathologies of the human pancreas [10,11]. Kayal et al demonstrated that this pro-tumorigenic environment not only supports the growth of implanted cancer cells but, unlike wt mice, also leads to the development of pancreatic neoplasia once mice are exposed to conditions that elicit mutations (carcinogen) and prolonged inflammation (cerulein) [2]. These results strongly support the notion that Hpa2 functions as a tumor suppressor; in its absence, tissues become more prone to the development of pre-malignant and malignant lesions.Unlike female Hpa2-KO mice, the male Hpa2-KO pancreas did not exhibit accumulation of fat, AAT, and ADM. However, foci ofinflammation were readily detected within the Hpa2-KO pancreas of young (3-month-old) and older (8-month-old) male mice. Kayal et al, then, exposed wt and Hpa2-KO male mice to cerulein, best recognized for its capacity to induce acute pancreatitis. Importantly, it was found that Hpa2-KO male mice responded vigorously to cerulein, resulting in the accumulation of fat cells and ADM to an extent comparable with female Hpa2-KO pancreas [2]. Thus, within one day, the morphology of male Hpa2-KO pancreas approached the morphology observed in the female pancreas, implying that abnormal cellular and molecular mechanisms were already turned on in response to Hpa2 knockdown, awaiting induction. Collectively, it was concluded that Hpa2 functions to preserve the identity of acinar cells; deficiency of Hpa2 results in pre-neoplastic pancreas which, in response to further insults, develops into pancreatic neoplasia. It is hoped that the protective effects of Hpa2 against cancer and inflammation will be translated to the development of Hpa2-based therapeutic strategies.

fig 1 new

Figure 1: H&E staining of pancreatic tissue sections showing the morphology of wild-type (wt) vs. Hpa2-KO pancreas and demonstrating the replacement of acinar cells by fat cells

Funding

These studies were generously supported by research grants awarded by the Israel Science Foundation (ISF-1021/19); The Israel Cancer Association (ICA), the US-Israel Binational Science Foundation (BSF2021059); and the Technion Integrated Cancer Center (TICC) Rubinstein scholarship (to YK).

References

  1. Grimont A, Leach SD, Chandwani R (2022) Uncertain Beginnings: Acinar and Ductal Cell Plasticity in the Development of Pancreatic Cancer. Cell Mol Gastroenterol Hepatol 13: 369-82. [crossref]
  2. Kayal Y, Barash U, Naroditsky I, Ilan N, Vlodavsky I (2023) Heparanase 2 (Hpa2) – A new player essential for pancreatic acinar cell differentiation. Cell Death Dis 14: 465. [crossref]
  3. Ziolkowski AF, Popp SK, Freeman C, Parish CR, Simeonovic CJ (2012) Heparan sulfate and heparanase play key roles in mouse beta cell survival and autoimmune diabetes. J Clin Invest 122: 132-41. [crossref]
  4. Dredge K, Brennan TV, Hammond E, Lickliter JD, Lin L, Bampton D, et al. (2018) A Phase I study of the novel immunomodulatory agent PG545 (pixatimod) in subjects with advanced solid tumours. Br J Cancer 118: 1035-41. [crossref]
  5. Galli M, Chatterjee M, Grasso M, Specchia G, Magen H, Einsele H, et al. (2018) Phase I study of the heparanase inhibitor roneparstat: an innovative approach for ultiple myeloma therapy. Haematologica 103: e469-e72. [crossref]
  6. Daly SB, Urquhart JE, Hilton E, McKenzie EA, Kammerer RA, Lewis M, et al. (2010) Mutations in HPSE2 cause urofacial syndrome. Am J Hum Genet 86: 963-9. [crossref]
  7. Pang J, Zhang S, Yang P, Hawkins-Lee B, Zhong J, Zhang Y, et al. (2010) Loss-of-function mutations in HPSE2 cause the autosomal recessive urofacial syndrome. Am J Hum Genet 86: 957-62. [crossref]
  8. Bonal C, Thorel F, Ait-Lounis A, Reith W, Trumpp A, Herrera PL (2009) Pancreatic inactivation of c-Myc decreases acinar mass and transdifferentiates acinar cells into adipocytes in mice. Gastroenterology 136: 309-19 e9. [crossref]
  9. Parte S, Nimmakayala RK, Batra SK, Ponnusamy MP (2022) Acinar to ductal cell trans-differentiation: A prelude to dysplasia and pancreatic ductal adenocarcinoma. Biochim Biophys Acta Rev Cancer 1877: 188669. [crossref]
  10. Khoury T, Sbeit W (2022) Fatty Pancreas and Pancreatic Cancer: An Overlooked Association? J Clin Med [crossref]
  11. Truong E, Pandol S, Jeon C (2022) Uniting epidemiology and experimental models: pancreatic steatosis and pancreatic cancer. EBioMedicine 79: 103996. [crossref]