Author Archives: author

Origin of Life in the Water of the Earth

DOI: 10.31038/GEMS.2023511

Abstract

The origin of life can be explained by the intermolecular interactions among molecules via a spiral structure of water. DNA is composed of D-type saccharides, and proteins are composed of L-type amino acids in most organisms on Earth, production of biomolecules is controlled by two types of chirality. The homochirality of biomolecules is evidence of the existence of a spiral structure of water. The chirality of molecules affects the selective chaining of L-type amino acid in protein. The main components of the cell membranes of living organisms today are C 16 H 34 (melting point 18°C, boiling point 287°C) and C18H38 (melting point 28~30°C, boiling point 317°C). There was a time when the H+ of the solar wind collided with CO2, the main component of the primordial Earth’s atmosphere, at 500 km/sec to produce hydrocarbon molecules, and the long-chain molecules of C16H34 and C18H38 floated as a membrane on the surface of the waters. When a spiral structure is formed on the surface of the water, homochiral molecules are selectively incorporated into vacant channels of the helix. With the oil film as the surface, the spiral structure group are aligned in water, and rearranged by thermal motion. Lipid molecules invade the vacant channel of the helix and are arranged perpendicular to the membrane surface by hydrophobic interactions, thus forming a cell membrane. The three-dimensional structure of amino acid molecules and water molecules interact to form a structure adapted to amino acids. DNA was created for storing amino acids sequences of proteins in a double spiral structure with intermolecular bonds in the middle part of the protein replication region. By converting long-lived DNA into short-lived RNA, RNA modified by amino acids becomes m-RNA that stores amino acid sequences and t-RNA that selectively carries molecules of other RNA amino acids. After a protein detached by formation of a ribbon, the same amino acids can be attached to the remained RNA. The genetic code (codon) corresponds to one amino acid in three sets of four bases, and all organisms on Earth have codons in common. The genetic code (codon) is nothing but a label of molecular structure that is a key-lock relationship between m-RNA and t-RNA. Thus, origin of life depended upon the movement of water molecules and spiral structures.

Keywords

Intermolecular bond, Spiral structure, Homochirality, Protein, DNA, RNA, Codon

Introduction

It is highly likely that life in the universe exists only on Earth [1] 2014. Theories of how life first originated from nonliving matter are classified into two categories: replicator first and metabolism first [2] 2007. Wherever something is produced, the producer and the resulting product must exist at the same time. Nucleosides, which are the building blocks of DNA, and amino acids which are the basic blocks of proteins, must exist at the same time to establish a relationship between them. Therefore, replicator and metabolism are necessary concurrently. Hunding et al. discussed that life began as a prebiotic ecology of co-evolving populations of macro-molecular aggregates [3] 2006. However, they ignored the origin of homochirality of biomolecules and the origin of the genetic code. F. Crick and J. Watson described the double helix structure of DNA which is composed solely of D-type sugars [4] 1953. This paper puts forward the hypothesis that water molecules form spiral structures. When liquid oil is dropped into liquid water, the hydrophobic hydrocarbon molecules gather on the surface of the water to form an oil film. Water molecules become organized in a “spiral structure (α-quartz lattice structure [5] 1974.) under the influence of the oil film. Although hydrocarbon molecules pass through vacant channel, lipid molecules insert into the vacant channels of the helix of water, and the hydrophobic molecules align vertically to the surface, and the membrane of a cell has formed. After a while, carbohydrates are produced on the surface of hydrocarbons floating on the surface of the water. The left-handed L-type amino acid and the left-handed D-type glycans that make up nucleic acids are concurrently generated in the living creatures of the Earth. The three-dimensional structure of water molecules around both regions interact to form an adapted structure where the three-dimensional structure of molecules characterized by individual amino acids is formed in contact with amino acids and t-RNA, but these two structures do not coalesce due to different chirality. Evolution is achieved by partial improvement during activities of the life to prolong its life. Each living creature was formed by individual organization of itself. Leveraging formed tissues is not a random process. Approximately 3.5~4 billion years ago, the intermolecular interaction of water molecules caused the structures of molecules to influence each other, and the DNA gene system was established.

Spiral Structure of Water Molecules

Evidence that Indicates a Spiral Structure of Water Molecules in Carbonated Water

Liquid water contributes to the building and repairing of cellular membranes, as well as relaying mechanical and chemical messages. Eisenberg and Kauzmann describe the structure and properties of water in detail [6] 1969. However, the dynamic properties of water such as organized movements of atoms in liquid water for metabolism remain unclear. The microscopic structure of liquid water changes every 10-12 s. Such instantaneous change of state is difficult to observe using modern technologies.

Figure 1 indicates the activation energy of water. calculated from temperature characteristics of water vapor pressure on ice (Kaye and Laby), and water: by Wagner and Pruss) [7] p.421. The melting heat of ice is 1.4 kcal/mol which is one 3.7th of the hydrogen bond formation energy. The small energy difference is caused by clusters of hydrogen bonds in the liquid water. When carbonated water is slowly frozen, CO2 forms spikes of bubbles within the ice which are similar in appearance to the spikes of sea urchins (Figure 2). This is the evidence that CO2 forms cocoon like molecule of surrounded by water molecules. Figure 3 shows the vacant channel of a helix, in which pairs of hydrogen atoms of a water molecule shown in yellow are lined up toward the vacant channel. A linear molecule of CO2, in which the electron cloud of the carbon atom is covered by the electron clouds of the oxygen atoms, fits in the vacant channel.

fig 1

Figure 1: The small energy difference between ice and water

fig 2

Figure 2: Elongated bundle of CO2 bubbles in the ice of carbonated water

fig 3

Figure 3: Structure of through-holes in liquid helix structure Blue allows indicate electric dipole moment Oxygen atom: blue, Hydrogen atom: yellow.

The spiral structure of α-quartz has the smallest size and lowest energy among various SiO2 crystal structures. The spiral structure of liquid water would be similar to that of α-quartz. At β- quartz to α-quartz phase transition, a systematic movement takes place as shown in Figure 5.There are vacant channels along the rotational axes of the spiral structure (Figures 4 and 5).

Figure 5 shows a model in which tetrahedral of H2O molecules in a helix make systematic thermal motions. Alternate vibration of rotation θ on each electric axis (± δ θ) involves extension and contraction, enable the entire molecular structure to generate movements that are reminiscent of respiration. If the vibration changes to one-way rotation, the systematic thermal movement of the spiral structure of liquid water molecules makes neighboring two way of streams. These streams can support the replication of protein. One stream is for protein and the other is for a m-RNA.

fig 4

Figure 4: Formation of α-quartz spiral structure (This illustration was reproduced from Ref. [5])

fig 5

Figure 5: Movement of water molecules in spiral white triangle indicates upward movement, and black triangle indicates downward movement.

Thermal Motion of H2O in a Spiral Structure Formed in the Vicinity of the Membrane of CO2 Bubbles

The downsize of helix and the energy decreases at the phase transition from β-quartz structure to α-quartz structure as shown Figure 4, the coupling angle of the connection points of the tetrahedron intermittently.

The downsize ratio depends on the rotational angle (θ). Contraction ratio for the optical axis (γ) is expressed by Eq. (1)

γz= (cos θ).                                                                          (1)

The contraction ratio for the electrical axis is expressed by Eq. (2)

γxy={(1+31/2cos θ)/(1+31/2)}.                                                (2)

The rotation of θ results a large temperature-dependence of α-quartz typed phase as shown in Figure 6.

fig 6

Figure 6: Temperature-dependence on the size of α-quartz1 (from Carpenter et.al. [8] 1998)

Structure of Spirally Arranged Water Molecules

Observations of Bubbles in Carbonated Water and Systematic Movements of Molecules

Karasawa reported how the acidity of carbonated water varied with the addition of iron powder [9] 2014. Metabolic reaction takes place in the material of intermolecular bond. As an example, material of intermolecular bonds was observed by mixing iron powder with carbonated water. Bubbles made of carbonated water and iron atom are always formed by intermolecular interactions at the boundary conditions between liquids and gases. So, even if the bubbles begin to crack, the defects are quickly repaired through the bubble formation mechanism. Adding changes to the bubbles from the outside helps with metabolism and thus prolongs the life of the membrane (https://youtu.be/GCL6Sv3WvOI). The intermolecular reaction is expressed by Fe(OH)2 + 2(CO2) ⇆ Fe(HCO3)2. This material generates the membrane of bubble that exhibits a metabolism.(https://youtu.be/M6n9kURDNg8). But the bubbles are disappeared, and only Fe2O3 remained.

The systematic movement of liquid water can be observed by the behavior of bubbles generated when thawing ice of carbonated water as shown in (https://youtu.be/BbaMVCgKrA8). We observed occasional phenomena such as CO2 bubbles that moved suddenly, coalescence of moving bubbles, and a moving bubble taken into the intermediate region of paired bubbles. This is evidence of the connection of liquid water by small size and low energy. When sudden movements of bubbles were observed, these occurred when the flow of oxidized carbon through the vacant channel of the spiral structure underwent a continuous swirling motion. Observed activities are difficult to explain without by spiral structure of molecules of low energy downsize structure formed from the plane of the membrane. When carbonated water is frozen, CO2 bubbles form and appears like spikes on sea urchins. This is evidence that CO2 molecules form linear molecules surrounded by water molecules as shown in Figure 7. The systematic movement of water molecules can be observed from the behavior of CO2 bubbles generated when thawing ice with carbonated water as shown in previous section. In the final state of thawing the ice of carbonated water, clusters of water like grapes are observed as is the coalescence of bubble of CO2 and the movement of bubbles in pair. If a stream of CO2 takes place in the helical structure, the alternate thermal vibration changes to rotation. White triangle indicates upward movement, and black triangle indicates downward movement. The movements of neighboring opposite stream of up-word and down-word are necessary for replication of protein as shown in Figure 5.

fig 7

Figure 7: An illustration of thermal motion of molecules in helix structure of a carbonated water

Liquid water becomes the lowest-energy structure (α-quartz type lattice) in which tetrahedral molecules are arranged in a spiral shape, and phase transition takes place. The spiral structure of water has channels perpendicular to the X-Y plane, and the molecules inner wall exposes hydrogen atom pairs to be rotated three times symmetry, and the molecules in the channels move up and down by the thermal rotational vibration of the hydrogen pairs. The systematic thermal motion of the spirally arranged water molecules synthesized the homochiral molecule. Most of biochemical reactions are carried out by the network of reactions in which adjacent atoms and molecules are exchanged by the thermal motion, so the amount of consumption on energy and nutrients are small.

Evidence that Surface Water Molecules form a Planar Structure

Reflected light has polarization that oscillates almost parallel to the reflective surface. When observing the surface of water with a slight wind blowing, the surface of the water appears to sparkle because the light polarized horizontally from the surface of the water enters the human eye. This is evidence that the water molecules on the surface of the water form a planar structure. Liquid water is a large molecular structure that frequently changes its three-dimensional structure by changing partner of hydrogen bonds. In the cell, all molecules cooperate and easily move by thermal vibration. Since three-dimensional structure of water molecules contains a spiral structure, the biomolecules that make up the organisms that inhabit the entire Earth are homochiral. Sunlight irradiates the primordial Earth, but there is no material that changes chirality in outer space along the way. The homochirality of biomolecules is evidence of the existence of a spiral structure of water. The generated homochiral biomolecules induce the formation of spiral structures in water to support biochemical reactions. That is, chiral molecules selectively combine to form large chiral molecules due to the helical structure of water. While hydrothermal vents as the origin of life are local areas and cannot be diffused to other regions.

The Oldest Organic Molecules in the Primitive Earth

There was a time when CO2 was the main component in the atmosphere of the primitive Earth. Researchers at UCLA and the University of Wisconsin–Madison have confirmed that microscopic fossils discovered in a nearly 3.5-billion-year-old piece of rock in Western Australia are the oldest fossils ever found and the earliest direct evidence of life on Earth [10] 2017. Tice, M. M., and Low were discovered in South Africa in large quantities of carbonaceous mud produced 3.4 billion years ago. [11] 1999. The cell membranes of current organisms have a structure in which C16 H34 or C18H38 are aligned vertically on the water surface. These molecules were synthesized in the atmosphere. That is, H+ at a high speed of 500 km/sec of the solar wind synthesized organic molecules in the upper atmosphere due to the collision of the H+ of the solar wind [12] 2022. The small hydrocarbon molecules produced remain in the atmosphere and undergo repeated synthesis reactions. C16H34 and C18H38 are hydrophobic long-chain molecules with a melting point of 20°C and a boiling point of 300°C, which float as an oil film on the surface of water [13] 2022. There are systematic thermal movements in which spiral structures line up in water based on the oil film surface. Under the hypothesis of spiral structured liquid water, formation of biological cell membrane will understand as follows. There are vacant channels surrounded by a tetrahedron of water molecules as shown in Figure 5 facilitates uptake of a long-chain alkane CnH2n+2, because such molecules have an elongated shape and are covered with hydrogen atoms [14] p.52, 2017. The hexadecane (C16H34) and octadecane (C18H38) are involved in transport of hydrocarbons through cell membranes.

How Cell Membranes are Constructed?

The cell membrane is one of the most important for the creature. Dyson came up with the world theory of “garbage bags”, in which many “garbage bags” containing miscellaneous molecules were formed in the primordial ocean [15] 1999. However, he did not describe the process of how cell membrane had formed. Figure 8 shows an illustration of a cell membrane.

fig 8

Figure 8: An illustration of a cell membrane

Origin of the Mechanism of Protein Production

Biomolecules are Homochiral because They are Produced by the Information Stored in DNA

The control system consists of two factors that are activated at the same time. The controller makes action to the object one directionally. The replication of protein is carried out where L-type of amino acids and D-type of sugars exist. The different chirality of DNA makes possible to control the production of proteins. Here, L-type of amino acid chain and D-type of sugar chains precede in the opposite direction similarly the positive screw and the reverse screw precede in the opposite direction with the same rotation. If working tools of D-type of sugar chains at first, the products of L-type of amino acid chain are controlled at a selected portion by difference of the chirality. In DNA, the region connecting the rows of two main chains is an intermolecular bond and can be separated. Since the base pair in the region of DNA where the amino acid is released has a key-lock relationship between amino acids, the same amino acids as the separated amino acids can be bonded. Under the helical movement of water molecules, the cell membrane syntheses proteins by systematic thermal motions of spiral structure. Proteins produced by peptide-bonding between L-type amino acids are released like ribbons. The protein linked with water molecules to form various three-dimensional structures.

Different Chirality of D-type of Sugar Controls Production of Protein

It is possible that carbohydrates (Cx(H2O)y) are produced on the surface of hydrocarbons floating on the surface of the water. So, there exist long-chain polymeric carbohydrates composed of monosaccharide units bound together by glycosidic linkages. A region of D-type sugar is added to surround the invading amino acids to form a tissue of helical sugar molecules modified with amino acids. The rotation meshed by the rotation of the gear is combined with the L-type amino acid sequence and D-type helix glycan. That is, direction of progress of L-type amino acid sequence is opposed to that of D-type helix glycan sequence. D-type helical sugar becomes the more stable molecular region through dehydration bonding, and the DNA is formed (Figure 9) [16].

fig 9

Figure 9: The symmetry of sense chain against antisense chain in the double layered structured DNA are as follows, L-type adenine for D-type thymine, L-cytosine for D-guanine, L-guanine for D-cytosine, and L-thymine for D-adenine.

Processes of Protein Replication by DNA

All living things on Earth have a DNA code with a common design is used. Until the period when living organisms evolved to the level where they had common DNA, the evolutionary process was carried out by intermolecular interactions in water.

The process to establish DNA gene system can be explained as follows:

  1. When a L-type amino acid invades a cell membrane, and the next L-type of amino acid makes a peptide bond form a ribbon shaped L-type of If D-type sugar is added to surround amino acid, the shift of stem on D-type helix sugar sequence is opposed to that of the protein.
  2. A D-type helix sugar region for one amino acid forms a region of t-RNA which is used for transporting of an amino acid to m-RNA.
  3. Progression of L-type amino acid sequence will form a series of D-type of t-RNA. The series of D-type of t-RNA will be surrounded by L-type of sugars, and one L-type of m-RNA will be formed. So, each step of L-helix and D-helix proceed in opposite directions as amino acid unit step.
  4. L-type of m-RNA is changed to a stable double helix of DNA, and it is kept for the replication of protein.

Codon as the Label that Identifies the Type of Amino Acid

Amino acids and DNA that are active in the vicinity at the same time of day influence each other and incorporate the features of the three-dimensional structure of amino acids into the structure of the region of the molecular row of the double helix of DNA. However, the information of the intermolecular sequence that is intermolecular bound is not changed from the outside due to facing the inside of the molecular row of DNA. Therefore, even after the double strands are separated individually, the same pair can be made by the relationship between the pair of locks and keys in the base sequence. Since it is easier to manipulate DNA in the case of proteins with a small number of amino acids, DNA was made with fewer amino acids in the early stages.

Molecules of water move via hydrogen bonds, and those molecules in contact with organic molecules also move via replacing neighboring molecules due to the thermal motion of molecules. Therefore, proteins are replicated in amino acid units by RNA equipped with a backbone region modified with amino acids. RNA and amino acids are connected by intermolecular bonds and have weak bonding force, and L-type amino acid selectively bond with L-type amino acid. Since it is peptide bonded, the protein becomes like a ribbon and is separated from the RNA. RNA that has released amino acids can bind the same amino acid back to the trace where the amino acid was taken away by intermolecular bonds. Genetic code (codon) is used as the label that identifies the type of amino acid. There are 64 species of codons and 20 types of amino acids. If amino acids are directly related to messenger RNA (which indicates the sequence of amino acids), amino acids bind selfishly to messenger RNA and accurate replication is not possible. Therefore, the relationship between t-RNA, (which carries amino acid) and m-RNA is checked by the genetic code that is not related to amino acids, and the amino acid sequence is determined through t-RNA only when the matching conditions are satisfied.

Production of Protein by DNA

The pairs of complementary base sequences of DNA are bounded by weak intermolecular bond. Since the regions of protein and that of DNA must be interacted at each amino acid, modification of amino acid units is carried out in t-RNA. But the pair of complementary bases are placed inward so that it does not change due to external influences. Since one of DNA is disappeared by generation of L-type of m-RNA and D-type of t-RNA, the double helix of DNA is unwound to form two lines of single-stranded DNA. Each single strand of DNA is used as the template to incorporate and replicate complement.

The process on a protein replication is described as follows and it is shown in Figure 9:

  1. One of DNA is used to produce D-type t-RNA and L-type m-RNA.
  2. The D-type t-RNA adhered with L-type of amino acid move to at the position assigned L-type m-RNA.
  3. Progression of L-type amino acid sequence by peptide bonds will form L-type protein (Figure 10).

fig 10

Figure 10: Role of chirality in protein replication. L-type of amino acid joins D-type of t-RNA, and the D-type of t-RNA bond with L-type of m-RNA. The proceed of right screw and left screw are reversed in case of the same rotation. So, L-type m-RNA proceeds in opposite directions to D-type of t-RNA as the unit of amino acid [17] “Molecular Biology of the Gene”, Fig. 8.11, 2004.

The base sequence is used as a label to distinguish the type of amino acid and the genetic code (codon). There are 64 types of  codons by combining 3 elements with 4 elements. Any of them corresponds to 20 kinds of amino acids used in living organisms. If amino acid molecules are directly related to m-RNA, amino acids bind as one pleases to m-RNA. Then, the accurate replication is not possible. The genetic code of m-RNA must not physical relationship with amino acids.

The Mechanism of Cell-division is Incorporated into the Cell Cycle

The double spiral structure separates the original and copied DNA in different directions at the replication. There are many separations of double spiral structures. Those separations can be performed simultaneously at the copying DNA. When paired DNA double helix structures are separated in different directions, the central region of the cell that divides in two becomes concave, then the central cell membrane contracts and closes, eventually dividing into two cells. Cell division is built into the cycle of organisms that continue to react without rest [17,18] “Molecular Biology of the Cell”, Chap.13, 1989. Due to the rotation of the Earth, the environment changes in a one-day cycle. With these changes, a cycle of biochemical reactions of cells occurs naturally. Each DNA corresponding to various proteins is replicated. As the DNA that controls biochemical reactions in cells evolves, there will be longer ones. The mechanism of chaining cell activities one after another and circulating those activities has evolved into life activities (Figure 11).

fig 11

Figure 11: Cycle of intracellular biochemical reactions

Conclusions

This study elucidated how the spiral structure of water led to the evolution of biomolecules, DNA, and, ultimately, life on Earth. It is known that the life of the structure of liquid water is about the minus 12 power of 10 seconds, and it cannot be directly observed. However, there are many phenomena those indicate that the molecules of liquid water have a systematic thermal motion. The fact that most biomolecules in living organisms are homochiral is the evidence that water molecules work together to construct spiral structures. Adjacent molecules in liquid water are exchanged in an intermolecular bonded system. If a spiral-type thermal motion of water molecules works together to create organized motion, we can explain formation of cell membranes, protein production, and protein replication by DNA, which are crucial to the origin of life. The sense and antisense strands in a DNA are connected by inter-molecular bonds and t-RNA is modified by the molecular structure of the region around amino acids at the time of generation. The complementary symmetry of sense chain against antisense chain is formed via mechanism of left-hand type spiral and that of right-hand type spiral. Therefore, even after the double strands are separated individually, the same pair can be made again by locks-and-keys relationship in the base sequence. The structure of DNA indicates how to synthesize protein that carries out activity of life. The primitive biochemical reactions are carried out with small energy consumption. After years of trial and error, the evolution of creature reached the level of DNA. By using mechanisms of DNA acquired, If the species’ evolution fits the environment, they thrive. If it is not suitable to the environment, they become extinct. The evolution of specie is adapted to the environment.

Acknowledgment

I thank Edanz (https://jp.edanz.com/ac) for editing a draft of this manuscript.

References

  1. Cady Lawrence P, André Brack, Jorge EBP, Charles Cockell, Gerda Horneck, et al. (2014) Aastrobiology editorial board opinions “Where do we go from here?” Astrobiology Editorial Office, Portland, Oregon, USA.
  2. Shapiro R (2007) A simpler origin for l Scientific American 296: 46-53.
  3. Hunding A, Kepes F, Lancet D, Minsky A, Norris V, et al. (2006) Compositional complementarity and prebiotic ecology in the origin of life. Bio Essays 28: 399-412, Wiley Periodicals, Inc. [crossref]
  4. Watson JD, Crick FHC (1953) A Structure for Deoxyribose Nucleic Acid. Nature 171: 737-738.
  5. Karasawa S (1974) Origin of Piezoelectricity in an α-Quartz. Japanese Journal of Applied Physics 13: 799-803.
  6. Eisenberg E, Kauzmann W (1969) The structure and properties of water. Pg: 73. Oxford Univ Press.
  7. Chronological Scientific Tables (2020) pg 421, pg: 872, (On ice: by Kaye and Laby), (on water: by Wagner and Pruss) p.421. Maruzen-Pub. Co. Jpn. 2019.
  8. Carpenter MA, Salje EKH, Graeme-Barber A, Wruck B, Dove MT, et al. (1998) Calibration of excess thermodynamic properties and elastic constant variations associated with the α↔β phase transition in quartz. American Mineralogist 83: 2-22.
  9. Karasawa S (2014) Prebiotic reactions in the bubble that was formed in carbonated water by iron atoms. Viva Origino 42: 12-17.
  10. Schopf JW, Valley JW, “https://news.wisc.edu/oldest-fossils-found-show-life-began-before-3-5-billion-years-ago/” Proceeding of National Academy of Science, 18, 2017.
  11. Tice MM, Lowe DR (2004) Photosynthesis microbial mats in the 3.416-Myr-old ocean. Nature 431: 549-552.
  12. Karasawa S (2022) Effects of Solar Wind on Earth’s Climate. Geology, Earth & Marine Sciences 4: 1-5.
  13. Karasawa S (2022) Earliest BIF and life produced via submarine volcanism in carbonated seawater. Geology, Earth & Marine Sciences 4: 1-5.
  14. Nelson D L, Cox MM (2017) Lehninger Principles of biology. 7th p.52, W. H. Freeman and Company.
  15. Dyson F (1999) Origins of Life. 2nd Ed. Cambridge University Press, Cambridge.
  16. McKee T, McKee JR, (2016) Biochemistry – The molecular bases of life. 6th Fig.1.13, Oxford Univ. Press.
  17. Watson JD, Baker TA, Bell SP, Gann A, Levine M, et al. (2004) Molecular Biology of the Gene. 5th Ed, Replication fork, Fig.8.11, Benjamin Cummings.
  18. Alberts B, Bray D, Lewis J, Raff M, Roberts K, Watson JD (1989) Molecular Biology of the Cell. 2th Ed, Chap: 13, Garland Publishing.

Foreign Body (Giant Radish) in the Colon

DOI: 10.31038/SRR.2023512

Abstract

Colonic foreign bodies are a selective case of gastrointestinal foreign bodies. A feature of clinical importance is the passage of large foreign bodies through the rectum to the sigmoid and descending colon. In this case, the development of intestinal obstruction, direct damage or the formation of bedsores of the intestinal wall with subsequent perforation and the development of fecal peritonitis is dangerous. In the vast majority of cases described in the clinical literature, foreign bodies were introduced voluntarily, about 10% of cases had a violent origin [1]. Often, out of shame, patients point to the “accidental entry” of an object into  the  rectum  as  the  reason.  Among  the  previously  described  in  the  literature,  we  find  a  variety  of  extraneous  rectal objects by type and size: an apple [2], a carrot [3], a rubber ball [4,5], a glass container [6], a plastic cover for a toothbrush [7] vase [8]. Methods of removal in each case are individual: from manual to laparotomy, depending on the depth of penetration and technical capabilities. We present our own observation of a patient with a giant radish of the colon that got through the anal canal.

Purpose: Indicate a rare case of a foreign body (giant radish) that entered the descending colon through the anus and was removed without laparotomy through the anal canal without the use of auxiliary instruments.

Keywords

Rectum, Colon, Giant foreign body of the colon

Main Part

Patient R., 62 years old, was admitted on November 16, 2021.   at 3 p.m. 50 min. to the surgical department with complaints about the presence of a foreign body in the rectum – «a stick carved from a radish».

It is known from the anamnesis: the mentioned complaints, according to the patient, appeared today, November 16, 2021, around 8:00 a.m. in the morning, after the patient himself stuffed a «radish stick, about 20 cm long» into his anus for the purpose of «massaging the prostate.» When the patient, according to him, felt that «the stick fell deeper into the intestine», he called the emergency room, which took him to the surgical department.

Objectively: the general condition is closer to relatively satisfactory. Consciously, emotionally labile. Hypersthenic, hypertrophic. Excess body weight 2 st. Tongue wet, clean. The abdomen is enlarged due to the patient’s obesity, inflated, participates in the act of breathing evenly, soft, sensitive on the left flank. There are no symptoms of peritoneal irritation. Gases are not passing well, there was no stool today.

Rectal (local status): at a height of 8-10 cm, the lower end of a solid foreign body with a smooth surface with a diameter of about 3 cm is palpated (balloted), the upper end of the foreign object is out of reach. No horizontal fluid levels were detected on the X-ray examination of Kloiberg’s cups, and no signs of a foreign body were detected. General analysis of blood, urine without special features.

The patient was taken to the operating room, where the anus   was devolved under intravenous anesthesia. The foreign body of the colon, by pressing on its proximal end (which was palpated after relaxation of the abdominal wall of the patient under anesthesia in the left hypochondrium), was sufficiently lowered to the middle ampullary part of the rectum, after which it was possible to grasp it with the fingers by the distal end and remove it (an attempt to remove with a window clamp was ineffective due to the object slipping out of the clamp branch). Removal of the foreign body from the patient was complicated by the difference between the external atmospheric pressure of 760 mm Hg. and significantly lower intra-abdominal pressure (normally 0-5 mm Hg), which caused a «suction effect»  and advancement of the object in the proximal direction during attempts to extract it. The foreign object turned out to be a cylindrical shaped shaved giant radish 25 cm long, with a maximum diameter  of 6.5 cm, with a condom stretched over it. On the foreign object are traces of feces mixed with minor impurities of dark blood. Bleeding during removal was not observed. The ampoule of the rectum and the perianal area are sanitized with antiseptics. Aseptic bandage.

The postoperative period was uneventful. The next day, the patient’s condition is satisfactory, the abdomen is soft, painless, physiological functions are not disturbed, the patient was discharged under the surgeon’s outpatient observation at his own insistence. Examined after 2 months: no intestinal disorders are noted [1-8].

Conclusions

The given case is interesting due to the deep penetration of a large foreign body through the rectum to the descending colon and its successful removal through the natural opening without laparotomy and the use of instruments that were useless in this situation.

References

  1. Cohen JS, Sackier JM (1996) Management of colorectal foreign bodies. J Roy Coll Surg Edin 41: 312-315. [crossref]
  2. Glaser J, Hack T, Rubsam M (1997) Unusual rectum foreign body: Treatment using argon-beam In: Endoscopy 29: 230-231. [crossref]
  3. Vashist MG (1997) Screwing a carrot out of the rectum. Indian J Gastroenterol 16: 120.
  4. Coulson CJ, Brammer RD, Stonelake PS (2005) Extraction of a rectal foreign body using an Int J Colorectal Dis 20: 194-195. [crossref]
  5. Nivatvongs S (2006) A simple technique to remove a large object from the In: J Am Coll Surg 203: 132-133. [crossref]
  6. Yaman M (1993) Foreign bodies in the Can J Surg 36: 1993: 173-177.
  7. Busch DB, Starling JR (1986) Rectal foreign bodies: Case Reports and a Comprehensive Review of the World’s Surgery 100: 512-519. [crossref]
  8. Couch CJ (1986) Rectal foreign Med J Aust 144: 512-515.

The impact of expedited third trimester viral load testing on the proportion of vaginal deliveries in HIVpositive pregnant women in the Dominican Republic

DOI: 10.31038/IGOJ.2023611

Abstract

Objective: Advances in HIV treatment have led to a significant decrease in vertical transmission. Lack of adequate viral load testing capabilities inhibited the ability to follow national and international guidelines for obstetric care in the Dominican Republic (DR). The objective of this study was to determine if expedited third trimester viral load testing in HIV-positive pregnant women led to an increase in vaginal deliveries at a clinic in the DR, thus demonstrating the ability to follow national guidelines for obstetric delivery of HIV-positive women on antiretroviral therapy (ART).

Study Design: This study enrolled pregnant HIV-positive patients at a clinic in the DR October 2014-July 2015. Viral load testing was performed 34-36-weeks gestation and results were available within 48 hours. Demographic information, clinical factors, and obstetric outcomes were collected and compared to patients in a retrospective cohort, who delivered January 2012-December 2012 when expedited viral load testing was unavailable.

Results: Of the 20 women in the study, 17 (85%) had viral loads <1000 and seven women (35%) delivered vaginally. In the comparison retrospective cohort, of 41 women, three women (7%) had vaginal deliveries. Comparing the two groups, there was a statistically significant increase in vaginal deliveries from 7% to 35% (p=0.02) after expedited viral load testing was made available. All infants born in the study were HIV-negative.

Conclusion: The study with expedited viral load testing available had an increased number of vaginal deliveries of HIV-positive women on ART. The majority of these patients were on ART with HIV viral loads <1000, and access to viral load results allowed for providers and patients to plan for vaginal deliveries as indicated by national guidelines. These results reinforce the importance of access to timely viral load testing for pregnant women with HIV and support previous research demonstrating no increase in vertical transmission from mother to infant during vaginal delivery.

Keywords

HIV, Vertical Transmission, Viral Load, Dominican Republic, Caribbean

Introduction

The Caribbean region has the second-highest prevalence of human immunodeficiency virus (HIV) in the world after sub-Saharan Africa, with the Dominican Republic (DR) and Haiti accounting for nearly two-thirds of all new HIV cases in this area [1]. Currently, approximately 72,000 individuals are living with HIV in the DR, yielding a prevalence of 0.9% in adults [2]. Although much progress has been made, mother-to-child (i.e., vertical) transmission of HIV remains significant, with approximately 1,300 children below the age of 15 living with HIV in the DR [2,3].

Advances in HIV treatment and monitoring are changing the landscape of vertical transmission of this disease. Current guidelines from the United States and DR recommend that women infected  with HIV receive antiretroviral therapy (ART) during pregnancy, because ART significantly decreases vertical transmission rates [4,5]. Before ART, Cesarean sections (C-section) were recommended for all HIV-positive women to decrease the risk of HIV transmission to the infant during delivery [6]. However, C-section carries significant risks including wound infection, infant respiratory problems, and a higher rate of maternal complications with future pregnancies (e.g., uterine rupture, placenta previa, placenta accreta, and bowel and bladder injury) [7]. As access to ART became widespread, studies demonstrated that pregnant patients on ART achieve a viral load  low enough to decrease the risk of vertical transmission such that C-section and vaginal delivery carry the same vertical transmission rate [4]. Additionally, the DR has one of the highest maternal mortality rates in the region and the second highest C-section rate   in Latin America [8,9]. International and Dominican guidelines now recommend that HIV-positive pregnant women who are on ART by the third trimester and meet certain criteria (e.g., HIV viral load less than 1000; negative syphilis, Hepatitis B, and Hepatitis C testing; fewer than two prior C-sections; no C-section in the past two years) should consider vaginal delivery in consultation with their obstetrician [4,5].

At the time of the study described herein, the DR had one viral load analyzer serving the entire country’s population and was unable to support the testing demands. Thus, most HIV patients were either not monitored for viral load every six months, as recommended, or had their results returned months after testing, thereby decreasing clinical utility.

Located in the town of La Romana in the south-eastern region of the DR, Clínica de Familia La Romana (CFLR) is a non-profit primary care clinic that provides ambulatory services and houses an HIV clinic, in addition to providing care to HIV-positive pregnant women and their infants through a vertical transmission program.  At the  time this study was initiated, all HIV-positive pregnant women receiving care at CFLR were scheduled for delivery via C-section at 38 weeks gestation. Although national and international guidelines recommend considering vaginal delivery for women on ART with viral loads under 1000 at 34-36 weeks gestation, providers at CFLR were unable to follow these guidelines, because the in-country viral load testing program could not provide the required results in a timely fashion.

This study aimed to determine whether expedited viral load testing would be associated with an increase in planned vaginal deliveries in HIV-positive pregnant women in a vertical transmission program in the south-eastern DR (i.e., at CFLR).

Methods

This pilot study of HIV-positive pregnant women enrolled in a vertical transmission program at a primary care clinic, CFLR, and at    its affiliated adolescent reproductive health clinic in La Romana in the south-eastern DR was performed from October 2014 through July 2015. All HIV-positive pregnant patients who were less than 36 weeks gestation and who were enrolled in CFLR’s vertical transmission program were recruited and enrolled after providing written informed consent.

Demographic, clinical, and laboratory data were collected from patient medical records including the date of HIV diagnosis, current ART treatment and adherence, obstetric clinical history, expected date of delivery, planned and actual mode of delivery, maternal and infant outcomes, infant treatment regimen, maternal CD4 count, maternal complete blood count, and infant HIV PCR results at six weeks    and six months post-partum. The mode of delivery was categorized as emergency C-section, elective C-section, or vaginal. Prior to initiation of the study, clinic physicians and staff were already aware of national guidelines for delivery options for HIV-positive pregnant women, so no additional education on these topics was necessary.

Whole blood specimens were collected from patients at 34-36 weeks gestation by trained CFLR phlebotomists. The samples were prepared and shipped overnight via FedEx to the New York Presbyterian/Columbia University Medical Center (CUMC) Clinical Microbiology Laboratory in accordance with specifications for the COBAS® TaqMan® HIV-1 Test, v2.0 and United States Category B infectious shipping regulations. Viral load testing was performed using the COBAS® TaqMan® HIV-1 Test, v2.0 in the CUMC Clinical Microbiology Laboratory and the results were uploaded within 48 hours from receiving the sample at CUMC onto a secure server for remote viewing by research staff at CFLR. Research personnel were available for questions and comments from staff and patients throughout the duration of the study. Research staff provided the HIV viral load results to the patient’s medical team at CFLR, who independently utilized the results in the patient’s care management and delivery planning and included the results in the referral paperwork that each patient brought with them to the hospital at  the time of delivery. The obstetricians at CFLR were often the same providers performing the deliveries at the hospital. Data on the mode of delivery and maternal and infant outcomes were later extracted from the patient’s medical record.

The mode of delivery and maternal and infant outcomes were compared to a historical cohort comprised of the clinic’s vertical transmission program patients from a prior year during which timely viral load testing was not available. The historical cohort included obstetric HIV-positive patients cared for at CFLR and who delivered between January 1 and December 31, 2012 for whom HIV viral load results were not available during late pregnancy. Of the 55 patients who delivered in this time period, six patients were excluded due to insufficient recorded data and eight were excluded due to diagnosis with HIV at the time of their delivery.

The study protocol was approved by the Institutional Review Board of CUMC and by the “Consejo Nacional de Bioética en Salud” (CONABIOS), the ethical review board in the Dominican Republic.

Statistical Analysis

Analysis of the retrospective cohort data from 2012 was used to calculate a clinically meaningful vaginal delivery difference for the pilot group. Since the retrospective data from 2012 did not contain sufficient information (i.e. third trimester HIV viral load) to posit which women would have met clinical criteria for a vaginal delivery, we estimated that 41% of women in the retrospective cohort would have met clinical criteria for a vaginal delivery, given that they were

(1) receiving appropriate suppressive ART (and would thus likely have a viral load less than 1000) and (2) had a parity < 2 (as a proxy for those who were less likely to have had a previous C-section, given a 50% C-section rate in the DR and since C-sections are the major exclusion criteria for vaginal deliveries). Given variability in patient and provider preference of delivery mode, we determined that a proportion of vaginal deliveries of 25% in the pilot study cohort (relative to 7% in the retrospective cohort) would reflect a clinically meaningful difference.

Descriptive statistics were used to characterize baseline characteristics, HIV viral load testing, mode of delivery, and infant HIV PCR test results. Fisher’s exact test was performed to test for differences in the mode of delivery between the pilot study cohort and the retrospective cohort. All analyses employed two-tailed testing with a threshold of p<0.05 considered statistically significant. Data were analyzed using OpenEpi.

Results

Twenty women were recruited into the pilot study cohort during the nine-month study period in 2014-2015 and 41 women were included in the retrospective (2012) cohort. Mean (SD) age of women was 21.2 (4.0) years in the pilot cohort and 25.7 (6.3) years in the retrospective cohort (Table 1). HIV viral load testing was successfully completed at CUMC on all 20 patients in the pilot cohort at 34-36 weeks gestation, whereas in the retrospective cohort, one patient had an HIV viral load performed at 34-36 weeks gestation (Table 1).

Table 1: Baseline characteristics, HIV viral load testing, mode of delivery, and infant HIV PCR test results for participants in the 2012 retrospective cohort and 2014 pilot cohort of HIV-positive pregnant women.

 

2012 Retrospective cohort (n=41)

2014 Pilot study cohort (n=20)

Maternal characteristics

Mean (SD)

 

Age (years)

25.7 (6.3)

21.2 (4.0)

     
 

N (%)

 

HIV viral load testing performed at 34 to 36 weeks gestation

1 (2%)

20 (100%)

Mode of delivery

   

Vaginal

3 (7%)

7 (35%)

Cesarean section

38 (93%)

13 (65%)

Infant Characteristics    

HIV PCR result at 6 weeks of agea

   

Negative

39 (97.5%)

21 (100%)

Positive

0 (0%)

0 (0%)

Indeterminate

1 (2.5%)

0 (0%)

HIV PCR result at 6 months of ageb

   

Negative

7 (87.5%)

20 (100%)

Positive

1 (12.5%)

0 (0%)

Indeterminate

0 (0%)

0 (0%)

aAt six weeks, there were N=21 infants in the pilot study cohort (one set of twins) and there were N=40 infants in the retrospective cohort due to loss to follow-up.
bAt six months, there were N=20 infants in the pilot study cohort (one infant passed away due to unknown reasons) and N=8 infants in the retrospective cohort (the remainder did not have 6-month HIV PCR results recorded in their clinical charts).

Of the women in the pilot cohort, seven (35%) delivered vaginally and 13 (65%) delivered by C-section. In the retrospective cohort, three (7%) delivered vaginally and 38 (93%) delivered by C-section. In the pilot cohort, 17 (85%) had viral loads less than 1000 copies per mL (meeting viral load criteria for a vaginal delivery), and of those 17 women, six (35%) delivered vaginally (Table 2). Of the three women with elevated HIV viral loads, two had C-sections and the third woman arrived at the hospital in labor with a precipitous vaginal delivery. The deliveries were otherwise uncomplicated.

Table 2: 2014 pilot study cohort viral load testing and mode of delivery (N=20)

 

HIV viral load <1000 copies/ml N=17 (85%)

HIV viral load ≥1000 copies/ml N=3 (15%)

 

N (%)

 
Vaginal delivery

6 (35%)

1 (33%)

Cesarean section

11 (65%)

2 (67%)

Compared to the retrospective cohort, the pilot study cohort where viral load testing and results were made available prior to     38 weeks gestation had a significantly higher proportion of vaginal deliveries (7% vs. 35%, p=0.02). The observed proportion of vaginal deliveries in the pilot study cohort (35%) was higher than the predicted proportion (25%) from pre-study calculated parameters. Although target enrollment was not achieved, the post-hoc power calculation using 20 participants revealed a power of 81%.

At six weeks of age, all 21 infants in the pilot study cohort (including one set of twins)  had  negative  PCR  HIV  testing  and 20 infants had negative PCR testing at six months of  age  (one infant passed away due to unknown reasons before the six-month time point) (Table 1). In the retrospective cohort, at six weeks of  age, 39 infants had negative PCR HIV testing, one infant had an indeterminate result, and one infant did not have a result due to loss to follow-up. There are limited data available for the retrospective cohort infants at six months of age; however, the infant with the initial indeterminate result had a positive result at six months of age. This infant was born via C-section to a mother who was diagnosed with HIV during pregnancy and started on antiretroviral therapy at the 28-weeks gestation.

Discussion

Overall, the availability of expedited viral load testing and access to results was associated with an increased likelihood of vaginal deliveries in this vertical transmission program in the DR. Additionally, there was no associated increase in vertical transmission of HIV, which is consistent with findings of other studies [10].

Nonetheless, our study had several limitations. As discussed previously, in the power calculation, there was difficulty determining the expected proportion of vaginal deliveries in the pilot study cohort given limited data from the retrospective cohort. The sample size for the pilot study cohort (N=20) was significantly smaller than the prior cohort (N=41) due to the implementation of a prenatal vertical transmission program at the local public hospital, where many women deliver their infants, absorbing much of CFLR’s patient load during the time the study was completed. Additionally, study time was decreased from 12 months to 9 months due to personnel limitations. Chart abstraction did not provide clear data on indications for C-section at the hospital, as hospital notes were not available. Due to patient loss to follow up and limitations in chart abstraction, there was missing data for infant HIV PCR results at six months of age. Finally, the statistical analysis performed to test for differences in delivery mode between the retrospective and pilot study cohort did not control for any additional variables that might have differed between the groups, due to limitations in data abstracted from the clinical charts.

Despite these limitations, having viral load testing performed and the results available in an expedited fashion provided women and their care team with the option of a vaginal delivery, in keeping with national and World Health Organization guidelines for HIV vertical transmission programs. Although the model used in this study (i.e., expedited shipping to an academic medical center in the United States) is expensive, findings from this study demonstrate the benefits of improved access to viral load testing equipment to evaluate HIV-positive patients, especially when it can dramatically alter management and avoid unnecessary abdominal surgery. In December of 2016, CFLR received a donation of a GeneXpert instrument for HIV viral load testing, in part, as a result of these study results. The clinic is now able to provide viral load testing on site, greatly reducing the time it takes to get results, both for pregnant women and for other HIV-positive patients. Although CFLR now has these capabilities, much of the DR still does not have access to timely viral load testing. As demonstrated by this study, increased access to and more efficient HIV viral load testing, analysis, and distribution of results could help to reduce the number of unnecessary C-sections in pregnant women with HIV in the DR.

Acknowledgements

We thank Jane Netterwald for expert technical assistance. Funding  was  provided  by  New  York Presbyterian/Columbia University Medical Center (CUMC) Clinical Microbiology Laboratory.

References

  1. Joint United Nations Programme on HIV/AIDS. Global AIDS Update 2018: Miles to go: The response to HIV in the Geneva: UNAIDS; 2018. [Crossref]
  2. Joint United Nations Programme on HIV/AIDS. Country Fact Sheets: Dominican Republic 2019. Geneva: UNAIDS; 2020.: [Crossref]
  3. Lorenzo O, Beck-Sagué CM,  Bautista-Soriano  C,  Halpern  M,  Roman-Poueriet J, Henderson N, et al. Progress towards elimination of HIV mother-to-child transmission in the Dominican Republic from 1999 to 2011. Infect Dis Obstet Gynecol. 2012;2012:543916.
  4. Panel on Treatment of Pregnant Women with HIV Infection and Prevention of Perinatal Transmission. Recommendations for Use of Antiretroviral Drugs in Transmission in the United Washington, D.C.: U.S. Department of Health and Human Services; 2020. Available from: [Crossref].
  5. Ministerio de Salud Pública. “Guía Práctica Clínica de las Infecciones de Transmisión Sexual,” Dominican Republic, 2013.
  6. Azria E, Kane A, Tsatsaris V, Schmitz T, Launay O, Goffinet Term labor management and outcomes in treated HIV-infected women without contraindications to vaginal delivery and matched controls. Int J Gynaecol Obstet. 2010;111(2):161-164. doi:10.1016/j.ijgo.2010.05.023.
  7. American College of Obstetricians and Gynecologists (ACOG) Committee on Obstetric Practice. ACOG Committee Opinion Number 559: Cesarean Delivery on Maternal Request. Obstet Gynecol. 2013 Apr;121(4):904-7. doi: 10.1097/01. AOG.0000428647.67925.d3.
  8. Gibbons L, Belizán JM, Lauer JA, Betrán AP, Merialdi M, Althabe World Health Report: The Global Numbers and Costs of Additionally Needed and Unnecessary Caesarean Sections Performed per Year: Overuse as a Barrier to Universal Coverage, Background Paper, 30. Geneva: World Health Organization; 2010. Available from: https://www.researchgate.net/publication/265064468_The_Global_Numbers_ and_Costs_of_Additionally_Needed_and_Unnecessary_Caesarean_Sections_ Performed_per_Year_Overuse_as_a_Barrier_to_Universal_Coverage_HEALTH_ SYSTEMS_FINANCING.
  9. World “Maternal mortality ratio (modeled estimate, per 100,000 live births),” Washington, D.C.: World Bank; 2010. Available from: https://data.worldbank. org/indicator/SH.STA.MMRT?order=wbapi_data_value_2010+wbapi_data_ value+wbapi_data_value-first&sort=asc.
  10. Garcia PM, Kalish LA, Pitt J, Minkoff H, Quinn TC, Burchett SK, et al(. Maternal levels of plasma human immunodeficiency virus type 1 RNA and the risk of perinatal transmission. Women and Infants Transmission Study N Engl J Med. 1999 Aug 5;341:6:394-402.

Plant-Based Proteins and Mind-Sets Underlying Concerns

DOI: 10.31038/NRFSJ.2023614

Abstract

Respondents rated degree of agreement/disagreement with combinations of phrases describing the environmental and social impacts of vegetable-based meats, following the Mind Genomics paradigm. The template comprised four questions dealing with different aspects of the topic (climate change, local benefits, land/energy, values), and four phrases providing specifics of each aspect. Each of 87 randomly selected respondents from the United States rated a set of 24 unique combinations, arrayed according to an experimental design. Two clearly different mind-sets emerged. Mind-Set 1 focused on the person and on the effects of human behavior. Mind-Set 2 focused on the external environment, not on people. The study shows the efficiency of Mind Genomics to address a topic at the level of granularity, doing so quickly, affordably, and with the ability to iterate repeatedly to create a large encompassing database of information about the topic.

Introduction

Today’s world has increasingly come to focus on the environment, on warming, on gases, and the deleterious effects of human agriculture and industry. It seems almost impossible to escape the issue and of course the associated rhetoric. The topic of our changing environment is clearly a cause for concern, but a concern which morphs beyond the disagreements in the popular press, to affecting the world of science. As of February 2023, Google(r) reported 1.6 million hits on the topic of ‘food and climate change.’ The topics in the scientific literature are striking, but modulated, disciplined, and subject to validation. The popular literature, however, expands the scientific range, moving into rhetoric, conflict about the meaning of the scientific findings, to alarmist literature about the road to extinction [1], and finally to business-based decisions, such as insurance policies based upon the proximity to the sea, and the weather [2].

In the middle of all of this has emerged the world of PBM, plant-based meat, meat analogs grown from plants, made into products which are advertised as tasty as beef. What before were simply non-meat analogs of meat, without the taste and certainly without the marketing pizzaz, has given way to visibility, competition, venture capital funding, and the appearance of stories about adoption, success, and financial performance [3], although during these early days of 2023 the ‘bloom may be off the rose,’ with some issues in the ongoing consumption of plant-based proteins [4].

It is to this world of emotion in the mind of people, and specifically emotion tied to agriculture, food, environment, and human welfare that we turn. A review of the literature suggests well-thought-out topics involving human coping with the environment as affecting food [5]. In this paper we move into the emotions involved in messaging, these emotions studied using disciplined experimentation implemented by the emerging science of Mind Genomics [6].

The Mind Genomics Paradigm

Traditionally, consumer researchers as well as political pollsters and others interested in public issues have attempted to understand what people think about either through discussion (so-called qualitative methods) or through questionnaires (so-called quantitative methods). With the advent of the internet, and the ability to track a person’s behavior, it is increasingly possible to link what people say to what people do. It should come as no surprise that there is a plethora of research on many topics simply because the methods available have burgeoned in number, and have become easier to use, and far more affordable.

What these methods often lack, however, is the ability to penetrate deep within the mind of the respondent. There are those involved in qualitative research as well as in observational anthropological research who believe that their methods allow the researcher insight into the mind of the respondents, simply because the matrix of material from which to study is so rich, and because the researcher is somehow attuned to such insights, a sort of ‘Listening with the Third Ear’ metaphor by psychoanalyst Theodor Reik [7]. For ordinary researchers one must assume that to a great degree the tools are too blunt to dive deeply below the surface to generate deep insights about a granular topic.

An opportunity to probe deeply into the mind of a person is hinted at by the study of memory, discovered almost a century and a half ago by experimenting psychologists. These researchers discovered that it is easier to let a respondent ‘recognize’, rather than to reproduce. The approach just mentioned, recognition vs reproduction, comes from research on memory. The researcher presents the test subject with material, waits a measured length of time, and either instructs the person to reproduce what the person remembers (so-called reproduction memory), or presents the respondent with different stimuli, some of which were presented, others not, instructing the respondent to identify out that which had been previously presented (so-called recognition memory) [8].

Coming from the world of experimental psychology, Mind Genomics combines experimental design with an approach inspired by recognition memory. The underlying notion of Mind Genomics is that people respond most naturally to stories. The stories, really combinations of messages, need not be polished, with correct tenses, connectives, and so forth. Rather, the stories comprise messages which paint a ‘word picture.’ There is no ‘recommended way’ nor ‘best practice’, other than to keep the size of the word picture within reason, so that the respondent can ’graze’, take in the information, digest it, and then generate a response. We embed the information into a matrix that can be quickly ingested and acted upon, not something which requires detailed reading and thinking. The researcher presents the stimulus, measures the response, and looks for patterns.

The typical Mind Genomics study work with a limited set of elements, combines them by an experimental design, presents the combinations (vignettes) to the respondent, obtains ratings, deconstructs the ratings to the contribution of the element, and arrives at the performance of the elements. Or in other words, and in a much simpler way, present mixtures of ideas, and measure the driving power of each idea. It is the idea of ‘recognition’ which emerges as the leitmotif of the process.

Mind Genomics: The Applications and the Paradigm Explicated by a Case Study

Over the past three decades, since the early 1990’s, Mind Genomics has found use in understanding how people make decisions about food. The number of papers and books is growing. One need only look at the three books on Mind Genomics for food concepts [9], package design [10] and general application [6] to get a sense of its power and promise. Beyond those books lie many dozens of papers dealing with specific topics. The topic of non-meat foods has been dealt with through Mind Genomics (with the papers part of a series of papers on different aspects of the newly emerging world of plant-based meat [11]. The paper presented here is one of those studies, presented in further detail.

Mind Genomics studies are best understood following the templated sequence of design, field implementation, and analysis. The actual research process of Mind Genomics has been embedded in a template which allows anyone, expert down to novice researcher, to explore the mind of people in almost any topic where human judgment is relevant.

Step 1: Choose the Topic

This step seems quite simple, but the simplicity is deceptive. For a Mind Genomics study to ‘work’ the topic must be at once large enough to generate interesting information about human beings and decision processes, but sufficiently delimited, so that the specific messages, the elements, possess granularity, immediacy, and a sense of the real world. We may talk about topics in general, but it is granularity which is important. The topic here is environmental issues and moral/social points of view regarding plant-based meats.

Step 2: Choose the Raw Material, Comprising Four Questions and Four Answers to Each Question

The Mind Genomics paradigm forces the researcher to deconstruct the problem or topic into a set of questions, each of which has different answers (also called elements). It is Step 2, the systematization of thinking at the up-front stage, which is problematic for many scientists. The researcher must stand back, and treat the topic in a dispassionate manner, looking at the topic as comprising four steps. The discovery of the four steps is the most difficult part of Mind Genomics. Recently, however, the Mind Genomics program (www.BimiLeap) has been augmented with artificial intelligence to help the researcher discover the relevant questions. The AI augmentation, Idea Coach, has only recently been embedded in the BimiLeap program, as was not available at the time of this study, run in 2019.

Table 1 presents the four questions (really aspects). For each of the four questions, the researcher is instructed to create four answers, generating a total of 16 answers. It will be these answers but without the questions, combined into small vignettes in Step 3 which will become the material to which the respondent will be exposed with instructions to rate the vignette as a total idea.

Table 1: The four questions and the four answers to each question

tab 1

Step 3: Create the Actual Test Stimuli, the Vignettes, and the Rating Scale

The Mind Genomics experience for the respondent is that the stimuli should comprise mixtures, combinations of elements or messages, simulating the combinations of stimuli one encounters in the environment. The respondent is presented with different combinations (the vignettes), along with a question and a rating scale. The respondent selects a rating from the scale for the specific vignette. The respondent evaluates different vignettes, rating each vignette on the same scale. The approach is radically different from the more conventional approach of ‘isolate and explore.’ The rationale is that through the evaluation of vignettes the researcher is reproducing the type of world of information which confronts the respondent every day. Mind Genomics simply takes that metaphor of combinations and converts the metaphor into a test reality by combining messages (answers) from Step 2. Note that the questions are never presented to the respondent. The respondent only sees combinations of answers. The questions are there to help the researcher create the answers.

The raw material comprises 16 elements, the four answers from each of the four questions. An underlying scheme, the permuted experimental design, creates a basic set of 24 vignettes, specifying the composition of each vignette. The 16 elements each appear five times across the 24 vignettes and are thus absent 19 times. A single vignette may have as many as four elements, or as few as two elements. No vignette contains more than one element from a question, but often a question does not contribute an element to the vignette. Finally, each respondent evaluates unique sets of 24 vignettes. The underly mathematical structures of the 24 vignettes are the same, but the actual combinations differ. This is known as a permuted design [12].

The precautions taken in the creation of the permuted design create three benefits:

  1. The vignettes cover many combinations, not just one combination. Compared to traditional methods studying the combinations, the Mind Genomics study evaluates a greater proportion of the design space, the possible vignettes. The researcher need not worry about having selected the proper set of 24 vignettes to test, which selection would mean that the research somehow ‘knew’ what combinations would be most fruitful to test. In practice the researcher need not know anything. It will the research which will reveal what is important, based upon the pattern of responses from the individuals who participate in the study.
  2. The Mind Genomics process builds in replication. Instead of measuring the response to the stimulus one time, the researcher measures the response to the stimulus five times, albeit in the presence of other elements.
  3. It is impossible to game the system. It is impossible for a normal person to figure out the underlying experimental design in the ‘heat of the moment,’ when reading 24 vignettes, one after another, each one taking about 1-5 seconds to read and evaluate.

fig 1

Figure 1: Three of the set-up screens for the Mind Genomics template. Each study is templated in the same way, with screens leading the researcher through the steps.

Figure 1 presents the three major screens in the Mind Genomics program (www.BimiLeap.com)

  1. The left screen requests the researcher to type in the four questions. The questions are shown as simple phrases, as an aid to the researcher. Thus Figure 1 shows simple phrases such as ‘climate changes,’ sufficient to help the researcher create the element, viz., the answer.
  2. The middle panel shows the four questions. The researcher reads the first question or phrases (climate change) and is prompted to put in the four answers. The answers are shown as full phrases. The emphasis to the researcher is to create element which create word pictures, not just simply one or two word answers.
  3. The right panel shows an example of the introduction at the top, a vignette in the middle, and the scale at the bottom.

Different concepts about environmental aspects of meat and meat-free products will be presented. Read all the statements and rate them as a WHOLE by answering the question below the statement.

Agree: 1=Not at all … 9=Completely.

Step 4: Launch the Study, Invite the Respondents, Specifying Country, Market, Age/gender if Desired, and Other Specifics

The study was run in the United States in 2019. The issue at that time was both to understand the topic of plant-based foods from a variety of viewpoints, as well as to determine whether there would be differences in responses between two parts of the country, California vs. New York.

The study called for 50 respondents in New York, and 50 respondents in California, about equally distributed by gender and by age. The cost of the study (4$ per respondent, complete, including the fee for the respondent invitation and participation) reflects the fact that the Mind Genomics platform was created as a service to the world of education, society, health, and business. The low cost makes it possible for anyone to become a researcher.

At the start of the evaluation the respondent recorded gender, age, and answer the preliminary question regarding their behavior and attitude towards meat and the environment

Preliminary question: Which of the following describes you the best?

1=I eat meat and do care about the environment

2=I eat meat and don’t care about the environment

3=I don’t eat meat and do care about the environment

4=I don’t eat meat and don’t care about the environment

5=Not applicable

The Mind Genomics program assembles the 24 different vignettes prescribed for the specific respondent and presents them in a specific order to the respondent. Previous studies suggested that the respondent should be given a practice vignette. The practice vignette is vignette #24. The vignette is presented to the respondent, but the rating is not recorded. The vignette will be presented again, as the last vignette, and then the rating recorded.

Preliminary inspection of the ratings showed that out of 102 respondents who ended up participating 15 respondents showed ratings either of 1-2, 8-9, or one rating across all 24 vignettes, respectively. These 15 respondents were removed from the data set, based upon the belief that the respondents were either not paying attention, or were agreeing or disagreeing with everything, and thus showing no ability to discriminate.

Step 5: Modeling to Relate the Presence/absence of the Elements to the Ratings

The essence of Mind Genomics is the effort to relate the presence or absence of the elements to the ratings. Most users of research accept Likert scales, such as the 9-point scale presented here, but feel uncomfortable interpreting the individual scale values. One way to help them is to anchor the ends of the scales, another way to help them labels each scale point, as was done in the introductory, self-profiling questionnaire, wherein the respondent classified herself/himself with respect to meat-consumption and feelings about the environment. For this study, the rating scale was simply anchored at both extremes, with no attempt to label the intermediate points.

The Mind Genomics system uses a Likert scale to quantify the response, since it is simple for the respondent. The subsequent analysis, after the data collection, transforms the scale into a binary scale, vs 100, a transformation which makes the data more understandable. The 9-point scale was divided into two sections, based upon a criterion which makes sense. for this study. Ratings 9 and 8 were assumed to denote ‘agreement’ and were transformed to 100, with a vanishingly small random number added. Ratings 1-7 were assumed to reflect either no agreement or an uncertain mix of agreement and disagreement. These later ratings were transformed to 0, again with a vanishingly small random number added.

The small random number added to the transformation ensured that the transformed ratings from one respondent would not either be 100 for all or 0 for all. The addition of the vanishingly small random number prevents the OLS (ordinary least squares) regression from crashing, which would occur when all transformed ratings are 0, or in the other case when all transformed ratings are 100.

Step 6: Surface Analysis of the Ratings

The first analysis focuses on the degree to which the ratings change while evaluating the 24 vignettes. For our study no two vignettes were the same, making it impossible to compare the average ratings by position for the same stimulus. Each vignette only appears once. However, it makes sense to average the ratings of all the vignettes appear in position 1 (first vignette tested out of the 24), position 2, and onward to position 24.

Figure 2 shows the average transformed rating (8,9 –>100) for all vignettes in position 1, position 2 … position 24. A line fitted to the data slopes upwards but very slightly. The reality from inspecting Figure 2 is that the pattern is random.

fig 2

Figure 2: Average percent of ratings ‘agree’ (ratings 9 and 8 transformed to 100) shown on the ordinate, vs each of the 24 positions in which a vignette could appear.

Step 7: Relate the Presence/absence of Elements to the Ratings and Uncover Mind-sets

The heart of Mind Genomics is the discovery of how elements ‘drive’ responses. The analysis is straightforward, made so by the judicious application of the permuted experimental design used in the construction of each respondent’s 24 vignettes. The analysis embedded in the BimiLeap program creates a database for all the data, 24 rows for each respondent. Each row corresponds to one of the 24 vignettes evaluated by that respondent.

The first set of columns in the each database record shows the respondent identification number, and the order of testing. The second set of 16 columns codes the composition of the vignette. Each of the 16 columns corresponds to one of the 16 elements, ranging from A1 to D4. When the when the element is present in a vignette, the number in the column (for that row) is ‘1’. When the element is absent from that vignette, the number in the column is 0.

The third set of columns shows the original rating, then the rating transformed to 0/100 (100 corresponds to 8,9; 0 corresponds to the remaining seven ratings 1-7), and the response time (RT) defined as number of seconds elapsing from the time the vignette was presented on the screen to the time that the rating was assigned, captured to the nearest tenth of a second.

The fourth set of columns shows the set of three classifications, gender, age, and behavior regarding eating meat and concern for the environment, respectively.

The matrix is immediately and automatically created at the end of the respondent’s evaluations. All the information is available from the study. Once the matrix is created and at any time the data can be totally analyzed since each respondent provides complete data, including the appropriate combinations of elements which allow the researcher to create an individual-level equation for the respondent.

The initial analysis creates 87 individual-level equations, each expressed as: Binary Response (Top2) = k1A1 + k2A2 … k16D4

Note that in this study the additive constant was not estimated. Continuing evaluation of the Mind Genomics methods suggest that the coefficients estimated without the additive constant correlate highly with the coefficients for the same study, this time estimated along with the additive constant. Thus, the patterns would be similar. The key difference is that the coefficients are larger when there is no additive constant. ‘Strong performing’ is here defined as a coefficient of +12 or higher, rather than +8 or higher (the value used when the additive constant is estimated).

The foregoing equation without the additive constant provides a measure of the ability of each element to drive the response. It will be the pattern of coefficients across all 87 individuals which will give us a sense of the nature of two or more groups, separated from each other based on the pattern of the coefficients. Such separation is accomplished by clustering, a way to separate ‘objects’ into non-overlapping groups based upon the patterns of their properties. The 87 rows x 16 columns were subject to a k-means clustering, to divide the respondents (rows) by the pattern of the coefficients [13]. The k-means clustering program works only on the mathematical properties of the dataset, attempting to split the respondents into two groups, and then three groups, so that the centroids of the groups on the 16 elements are as different (distant) as possible, whereas the individuals within a group are similar (close) as close as possible. The measure of distance between people, and between centroids was defined operationally as (1-Pearson R). The Pearson R, or the correlation, takes on the value +1 when two patterns are identical; the distance between them is 1-1, viz., 0. The Pearson R takes on the value of -1 when two patterns are identical; the distance between them is 1- -1, viz., 2.

The values for the coefficients based upon the Top2 (Ratings 9,8 –>100) appear in Table 2. The table shows the elements sorted based upon the values of the two emergent mind-sets, discussed below. The important thing to notice in Table 2 are those elements with coefficients of +12 or higher. Statistical analysis using OLS (ordinary least squares) regression, suggests that coefficients of this magnitude become statistically significant as well as ‘meaningful’ in a real-world sense when the equation is estimated without an additive constant.

Table 2: Coefficients for models relating the presence/absence of the elements to the level of ‘strong agreement’ (rating 9, 8 converted to 100). Strong coefficients (+12 or higher) appear in shaded cells. Coefficients of 5 and below are not shown.

tab 2

The importance in a Mind Genomics study is not the magnitude of a single element nor its difference from 0, but rather the pattern of coefficients for a single group. When we look at the first data column, corresponding to Total Panel, we fail to see truly strong elements emerging, viz., elements which generate a coefficient of +12 or more. This is not surprising, given the ability of Mind Genomics to uncover groups of individuals with different patterns of coefficients, suggesting different ways of thinking about the same topic. Putting together these different mind-sets into one database ends up attenuating the strong patterns of each.

Table 2 shows the results from the clustering. The two-cluster solution, shown in the second and third data columns, suggests two clearly different mind-sets, groups of individuals who, faced with the same material, think in different ways. Mind-Set 1 focuses on the human being, and the effects of human behavior. Mind-Set 2 focuses on the external environment. Note that in the interest of allowing the patterns to emerge, the table shows coefficients of 12 or higher in shaded cells. There might well be more mind-sets, but for the purposes of this exploratory research two mind-sets suffice to demonstrate the radically different patterns. Extracting the third mind-set did not reveal a new group with a demonstrably new pattern of coefficients.

Table 3 shows the self-profiled classification of the respondents in the two mind-sets. The base sizes do not always add to 87 because in some cases the respondents left out the answer to one of the classification questions.

Table 3: Classification of the respondents by gender, market, meat-eating, and concern with the environment

tab 3

Step 8: Measure Engagement with the Messages Using Response Time

Today’s concern with the environment continues to generate controversy, and emotion. The notion that our omnivore habits are the cause for climate change through animal farming continues to emerge, again and again, both in the popular press and in academic literature [14,15]. With the attention paid to climate, and with the importance of food and the increasing focus on vegetable-based meat, we have an opportunity to investigate the degree to which messages grab the attention of people, engaging them, not through a conscious probe of what they ‘feel’, but rather in the amount of time the person gives to reading, digesting, and then responding to the messages.

The Mind Genomics platform provides a measure of engagement through the response time. Response time is defined as the time elapsing from the moment the stimulus is presented until the moment the respondent. A small prophylactic measure moves all response times of 8 seconds or longer either to 8 seconds (done here) or removes the data point from analysis (not done here). The rationale for this prophylactic measure is that the respondents may be multi-tasking, which would produce a false measure of response time for the vignette.

The model for response time is the same as the model for the transformed rating, viz no additive constant. The 16 coefficients show the number of seconds that can be ascribed to each element, including reading and judging. Table 4 shows these coefficients for the total panel, and for both mind-sets.

Table 4: Response times in seconds attributed to each of the elements, by total panel and two mind-sets. The numbers in the body of the table are the number of seconds attributable to the element.

tab 4

The response times suggest dramatically different patterns of attention. Those respondents in Mind-Set 1, focusing on people and the human aspects, pay little attention to the elements. The only element to which they pay attention is B1, Meat substitutes can be produced by local farmers also (RT coefficient = 1.0). In contrast, those respondents in Mind Set 2, responding to the environment, pay more attention to certain elements, viz., those elements focusing on the environment.

A1           Meat substitutes help to decrease greenhouse gas emissions                                   1.5

C2              When eating meat substitutes, no animals are harmed                                       1.4

C3              The increased meat demand contributes to significant biodiversity loss             1.3

A3              Meat production has little or no effect on climate change                                    1.2

Step 9: How Mind-sets Process Interactions between Pairs of Elements

Our previous analysis focused on the performance of individual elements, showing clear differences between elements according to the two clearly different mind-sets. We saw two radically different mind-sets emerge, differing both in the elements which drive their agreement, as well as the speed at which they process information. These mind-sets focus on topics, but also represent different types of individuals. It would appear from informal observation that people who focus on the climate (Mind-Set 2) seem to be more outwardly verbal about the topic. In contrast, people who focus on the behavior of other individuals (Mind-Set 1) seem to be quiet.

Do these two mind-sets differ in the way they process information? That is, when we provide the respondents with combinations of the same type of elements versus different types of elements, how do they respond to the combination? Do the elements synergize, or suppress each other? Our strategy to assess interactions is called scenario analysis [6]. Scenario analysis follows these steps:

a. Select one question which will define the five different strata. This will be Question B, pertaining to ‘local benefits.’ Two of the four elements from Question B focus on people (B2 Meat substitutes can be produced by local farmers also; B4 Locally produced meat is better than meat substitutes). The remaining two elements from Question B focus on the environment (B1 although meat production contributes to climate change, it is not the main cause; B3 By eating meat-free, the local environment will be saved).

b. Working with the entire database of 87 respondents x 24 rows/respondent, divide the database into five groups or strata, each stratum determined by the specific element from question B. The first stratum comprises all vignettes containing element B1. The second stratum comprise all vignettes containing element B2 and on to the fifth stratum, which contains no element from question B. We will not consider the fifth stratum, those vignettes lacking an element from Question B.

c. We create four equations, one per stratum, relating the presence/absence of the remaining 12 elements to the transformed rating, the dependent variable (DV). The equation is: expressed as: DV=k1(A1) +k2(A2) +k3(A3) +k4(A4) +k5(C1) +k6(C2) + k7(C3) +k8(C4) +k9(D1) +k10(D2) +k11(D3) +k12(D4)

d. Table 5 presents the strong performing coefficients, defined operationally for this table only as a coefficient of +20 or higher. These very strong performing coefficients are presented in shaded cells. The remaining coefficients are suppressed, allowing the patterns to emerge.

Table 5: Scenario Analysis. The coefficients of elements from Questions A, C and D for different ‘strata’ defined by a fixed element from Question B.

tab 5(1)

tab 5(2)

e. For Mind-Set 1 (focus on people), synergisms among elements occur when elements about the person are combined either with other elements about the person, or with elements about the environment. In fact, Mind-Set 1 shows six strong interactions out of 24 possible interactions between pairs of elements, one about environment, the other about the person. Mind-Set 1 seems to be able to take in all the information in the vignette to assign the rating. We do not get a sense of overly-focused perception on the topic of food and the environment.

f. Mind-Set 2 (focus on the environment) thinks differently, showing only two strong interactions out of 24 possible interactions. We get a sense of people in Mind-Set 2 thinking in a more focused manner, looking primarily at the messaging about the environment, not focusing on any other type of message.

Discussion and Conclusions

We can barely listen to the ever-updated business reports without hearing of the successes and now troubles or even failures of companies in this new food ‘space.’ Furthermore, the ability of concerned individuals to invoke issues of great emotionality such as the environment increases the intensity of the noise as it does the intensity of the signal [16].

The Mind Genomics exploration of the intersection of the environment and plant-based meats provides a way for the researcher to understand topics where there may be as much ‘noise’ as there is ‘signal. Mind Genomics studies are run in what might be called a ‘sterile’ fashion, without leading questions, but with test stimuli which may run the gamut from simple factual statements to statements designed to appeal to the emotions, with or without supporting facts. By testing the elements of all types in ever-changing combinations, it becomes possible for the researcher to assess the strengths and weaknesses of these statements as the consumer respondent see them, while preventing the respondent from ‘gaming’ the system. No matter what the mind-set of the respondent may be, the ever-changing combinations mean that the respondent ends up assigning honest ratings, even if the respondent feels that the rating is a ‘guess.’ The data in Tables 2, 4 and 5 reveal a great deal of consistency.

The complexity of thinking around the emotional and ethical response to the topic of ‘plant-based meat’ is staggering. A Google search of the topic of plant-based meat reveals 2.85 million hits, during early February 2023. Going more deeply into the topics of environment versus effect on people, the same topic of ‘plant-based meat’ combined with ‘effect on people’ generates 1.61 million hits. In turn, ‘plant-based meat’ combined with ‘effect on the environment generates 2.06 million hits. One must read a great deal about the topic to begin to intuit the existence of the two mind-sets. In contrast, almost immediately, the Mind Genomics exercise provides a sense of how people organize the topic. From the practical point of view, Mind Genomics provides a path to selecting the information appropriate to present to the audience, once it can be determined the mind-set to which the person belongs. If that capability is not available, then the next strategy is to explore different messages with individuals of known mind-sets, selecting an array of messages likely to appeal to each mind-set, while not alienating the other mind-set.

A search through the published literature confirms what was found in this study, namely that there are at least two different directions of thinking about the topic. On the one hand, there are those papers focusing on people and their intersection with the world of plant-based foods, viz. our Mind-Set 1 [15,17-19]. In contrast, there are those papers which deal with the issues of food and the environment, viz., our Mind-Set 2 [20,21]. What is missing from these papers, however, is the way people think, the nature of how they incorporate information, and how they combine similar types of information versus dissimilar types of information about the topic. It is as if the Mind Genomics approach might provide ‘informational mortar’, to help the other data provide deeper insights [22].

As it is worthwhile finishing this paper with some observations about the role of Mind Genomics in the ‘Project of Science. People are not accustomed to ‘design thinking.’ Most of the ideas which people proffer appear to emerge fully developed, or perhaps seem to require slight modification. There is the mystique that creating a new idea occurs during the almost impossible-to-describe ‘creative leap of faith.’ The likelihood of successfully bringing this leap of faith to business is thought to be by better ‘insights.’ Such insights believed to likely emerge when one uses by focus groups, in-depth interview, ‘creative exercises,’ or gives over the task to people who are deemed to be ‘creatives’, the latter either because of their corporation position or because they score well on a test presumed to measure ‘creativity.’ Creativity is elevated to an art, one which is special, but can be learned.

The elevation of the creative act into almost mystical moments, achievable of course by everyone, means that the mystique must be preserved. It is the thinking, the ‘aha’ experience, which is important. It is the idea, emerging like Venus, almost fully formed, with some need of polishing, which is important. Consequently, much of the research conducted today with consumers is commissioned to validate or falsify a hypothesis, a test of the consumer acceptance of one’s idea in business. It should come as no surprise then that the Russian wisdom is touted again and again; measure nine times cut once. It is at the point of cutting, of making a yes/no decision about the object created that the research effort is executed.

The Mind Genomics approach differs. Mind Genomics can be considered a cartography, an exercise in mapping terrain, terrain which is new, or terrain that has been well trodden but needs new measurement for one or another reason. The implementation of this of mapping exercise occurs in a straightforward manner; present different stimuli to the respondent, measure the reactions to these stimuli, and from the pattern of those reactions identify the driving power of each of the elements to ‘drive; the response. The approach is akin to creating the blueprints of a system, showing through experimentation how the different parts work together to drive the response. The steps are simple, iterative, and powerful in that they deal directly with the relevant stimuli, without having to force interpretation. It is likely that, when implemented in simple, small, affordable experiments like the one reported here, design thinking will prove its value, showing how the system ‘works’, identifying ‘what to do’, and then ‘what to communicate about what one has done.’

References

  1. Araújo MB, Whittaker RJ, Ladle RJ, Erhard M (2005) Reducing uncertainty in projections of extinction risk from climate change. Global ecology and Biogeography 14: 529-538.
  2. Bush DM, Neal WJ, Young RS, Pilkey OH (1999) Utilization of geoindicators for rapid assessment of coastal-hazard risk and mitigation. Ocean & Coastal Management 42: 647-670.
  3. Bonny SP, Gardner GE, Pethick DW, Hocquette JF (2017) Artificial meat and the future of the meat industry. Animal Production Science 57: 2216-2223.
  4. Demartini E, Vecchiato D, Finos L, Mattavelli S, Gaviglio A (2022) Would you buy vegan meatballs? The policy issues around vegan and meat-sounding labelling of plant-based meat alternatives. Food Policy 111.
  5. Van Vliet S, Kronberg L, Provenza FD (2020) Plant-based meats, human health, and climate change. Frontiers in Sustainable Food Systems 128.
  6. Moskowitz HR, Gofman A (2007) Selling Blue Elephants: How to Make Great Products that People Want Before They Even Know They Want Them. Pearson Education.
  7. Grotjahn M (1950) About The “Third Ear” In Psychoanalysis: A Review and Critical Evaluation of: Theodor Reik’s “Listening with the Third Ear; The. Psychoanalytic Review 37: 56-65. [crossref]
  8. Jacoby LL, Wahlheim CN, Coane JH (2010) Test-enhanced learning of natural concepts: effects on recognition memory, classification, and metacognition. Journal of Experimental Psychology: Learning, Memory, and Cognition 36: 1441-1451. [crossref]
  9. Moskowitz HR, Porretta S, Silcher M (2008) Concept research in food product design and development. John Wiley & Sons.
  10. Moskowitz HR, Reisner M, Lawlor JB, Deliza R (2009) Packaging research in food product design and development. John Wiley & Sons.
  11. Gere A, Harizi A, Bellissimo N, Roberts D, Moskowit H (2020) Creating a Genomics wiki for non-meat analogs. Sustainability.
  12. Gofman A, Moskowitz H (2010) Isomorphic permuted experimental designs and their application in conjoint analysis. Journal of Sensory Studies 25: 127-145.
  13. Likas A, Vlassis N, Verbeek JJ (2003) The global k-means clustering algorithm. Pattern Recognition 36: 451-461.
  14. Djekic I (2015) Environmental impact of meat industry – current status and future perspectives. Procedia Food Science 5: 61-64. Djekic I (2015) Environmental impact of meat industry – current status and future perspectives. Procedia Food Science 5: 61-64.
  15. Pimentel D, Pimentel M (2003) Sustainability of meat-based and plant-based diets and the environment. The American journal of clinical nutrition 78: 660S-663S. [crossref]
  16. Macdiarmid JI, Douglas F, Campbell J (2016) Eating like there’s no tomorrow: Public awareness of the environmental impact of food and reluctance to eat less meat as part of a sustainable diet. Appetite 96: 487-493. [crossref]
  17. Broad GM (2020) Making meat better: The metaphors of plant-based and cell-based meat innovation. Environmental Communication 14: 919-932.
  18. Curtain F, Grafenaue S (2019) Plant-based meat substitutes in the flexitarian age: An audit of products on supermarket shelves. Nutrients 11: 2603. [crossref]
  19. Slade P (2018) If you build it, will they eat it? Consumer preferences for plant-based and cultured meat burgers. Appetite 125: 428-437.
  20. Joshi VK, Kumar S (2015) Meat Analogues: Plant based alternatives to meat products-A review. International Journal of Food and Fermentation Technology 5: 107-119.
  21. Siegrist M, Hartmann C (2019) Impact of sustainability perception on consumption of organic meat and meat substitutes. Appetite 132: 196-202. [crossref]
  22. Saulo AA, Moskowitz HR (2011) Uncovering the mind-sets of consumers towards food safety messages. Food quality and preference 22: 422-432.

Empowering Young Researchers: Cognitive Economics and the Features Associated with Minimum Wage

DOI: 10.31038/ASMHS.2023713

Abstract

Respondents evaluated unique combinations of messages dealing both with the levels of minimum wage, and reasons for minimum wage, selecting one of five minimum wages that would fit each combination, respectively. The underlying experimental design ensured that each respondent had the appropriate set of vignettes so that it would be possible to create an equation showing the ‘dollar value’ of each of the messages. Regression modeling and clustering analysis revealed three emergent mind-sets, (Government should do the work; Individual should save money; Individual should suffer). The most effective messages to generate higher ratings of minimum wage were those suggesting what the person might do in order to economize, and live within their means. The least effective messages were those talking about what the government should do regarding minimum wages. Respondents paid attention to dollar values of minimum wage primarily for messages which presented additional information, such as the specific state where that minimum wage was the law. The paper shows the potential for creating a new learning and research paradigm for students, incorporating artificial intelligence to suggest questions and answers about a topic (learning phase), coupled with a templated program to acquire the responses to real people to the information provided by AI (experiential learning through research).

Introduction

The topic of minimal wage, often called minimal living wage, continues to draw attention, year after year [1]. Whether the issue is considered from the vantage point of economics [2,3], consumer research (e.g., [4]), or as part of the corpus of topics focused in by social planners and government economists [5], the topic never ceases to draw attention. Indeed, major treatises have been developed by economists relating minimal wage to a variety of other issues in society, both structural and behavior (e.g., [6]). And, of course, the sheer relevance of minimum wage continues to be the topic of numerous popular articles, and op ed letters (e.g., [7])

This paper emerged from the efforts of a student researcher in middle school in the Bronx, New York, the first author, Cledwin Mendoza. The topic was part of the senior author Mendoza’s effort to use Mind Genomics to explore the topic of minimum wage, from the point of view of a student looking at the world of adults, a world that he would soon enter. The underlying strategy was that to better understand the topic of minimum wage, one might explore some aspect of the topic from the point of view of a middle school student, using a combination of artificial intelligence to help frame questions and answers, along with one’s own experience to modify the output of artificial intelligence. The next step would be to understand how other young people would respond to these ideas. The strategy combines learning through questioning with artificial intelligence, and then evaluating what is learned by experiments with real people. The effort is called Mind Genomics, the computer program is BimiLeap, and the effort may be best understood as experimental analysis of topics of the everyday.

The study focuses on the ability of different messages about minimum wage to ‘drive’ estimated dollar values of the minimum wage. That is, the desire was to learn whether there were any types of messages which convinced people to increase the minimum wage that a worker might receive, and to the contrary, what types of messages convinced people to actually lower the minimum wage that a worker might receive.

Mind Genomics and ‘Cognitive Economics’

The approach used in this study is known as Mind Genomics, with a specific variant, known as Cognitive Economics. Mind Genomics is an emerging science focusing on the way we make decisions about the topics of the everyday [8,9]. Mind Genomics was founded on the belief that a strong way to understand people’s decisions is to present them with combinations of features relevant to the decision making (so -called vignette, which combine together elements), instruct the respondent to make a decision (e.g., assign a rating to the vignette), and then after having presented the respondent with an appropriate set of such vignettes, obtain the ratings, and deconstruct the pattern of rating into the contribution or driving power of each message, each element. In other words, combine elements, present combinations, get ratings, deconstruct the response, and create the knowledge base. The paper will explain each of these.

Method

The Mind Genomics approach followed a choreographed process, the steps set up to prepare the data for statistical analysis using OLS (ordinary least-squares) regression. The objective of the analysis is to generate a model, viz., an equation, relating the presence/absence of the raw materials (messages about minimum wage) to a dependent variable. For the study reported here, the dependent variable is a selection of an appropriate minimum wage, based upon how the respondent interprets the messages about minimum wage.

Step 1: Define the Topic, and then Create Both Questions and Answers (Messages) Which Present Information about Minimum Wage

The Mind Genomics process is an exploration, so the researcher need not know anything about the topic of minimum wage to do an experiment and discover how ‘people think about minimum wage.’

This approach of beginning with questions and answers, even in the almost total absence of knowledge, stands in stark contrast to the conventional method which assumes that the research is grounded to answer a specific problem existing in the state of knowledge. The latter is called the hypothetico-deductive system, positing that research should enable one to confirm or to falsify a hypothesis, a hypothesis grounded in one’s knowledge of the topic.

From the beginning researchers may know very little about the topic and need guidance. The Mind Genomics program, www.BimiLeap.com, provides a coaching system, Idea Coach, in which the researcher types in a sentence about the topic, with Idea Coach powered by artificial intelligence (Open AI) returns with 30 questions.

Table 1 presents the query, and two sets of 30 questions about minimum wage returned by the Idea Coach. The important things to note are that the Idea Coach can be used to investigate the topic and/or to select specific questions to use for BimiLeap, thus playing both a teaching role and a direct coaching role for the study. For this study the student researchers used Idea Coach as a teaching aid, and then formulated the questions and answers afterward.

Table 1: Example of two sets of questions about minimum wage generated by Idea Coach

tab 1(1)

tab 1(2)

tab 1(3)

Table 2 shows the four questions and the four answers to each question. The Idea Coach presented these elements as answers to the four questions that the senior author selected. Once again, it is important to note that the questions were not immediately provided by Idea Coach and its AI substructure, but rather emerged after the senior research (Cledwin Mendoza) ‘learned about the topic’ using Idea Coach as an interactive tool to explore different aspects of the topic.

Table 2: The raw material, comprising four questions and four answers to each question

tab 2

Step 2 – Create Test Vignettes, viz., Combinations of Elements

In a Mind Genomics study, the respondent is instructed to rate combinations of elements, these combinations describing a situation or an offer. The strategy of testing combinations rather than single elements allows Mind Genomics to simulate what might be encountered in the ‘real world,’ which virtually always presents a person with mixtures of features to which the person must react. The notion of isolating the features and then instructing the respondent to evaluate each feature, one feature at a time, comes from the traditional world of science, where isolating a variable allows a deeper study of that variable. With a person, however, presenting a single idea out of context may end up making that single idea meaningless, as is the case for elements A1-A4, and B1-B4 in Table 1. These elements are simple ‘facts’, devoid of deeper meaning when presented alone.

To study these elements Mind Genomics mixes the elements into small combinations, the aforementioned ‘vignettes. A vignette is simply a collection of elements, one element at top of the other, without any effort to connect the elements into a grammatically correct whole. By presenting the vignette as the disconnected combination of elements in this austere format, the researcher ends up making the task easy, because the respondent can ‘graze’ through the elements and make a decision.

The actual design comprises 24 vignettes, each vignette containing two, three, or four elements, respectively. In any vignette, only one element (answer) from a question may appear, preventing a vignette from presenting two elements which may directly contradict each other. Across the 24 vignettes, each element appears five times, and is absent 19 times. Each set of 24 vignettes ensures that the 16 elements are statistically independent of each other, and thus the data from one set of 24 vignettes can be subject to regression analysis. Finally, each respondent evaluates a totally unique set of 24 vignettes. No two respondents evaluate the same set of vignettes, nor even the same vignette. These powerful features allow the researcher to evaluate a great number of combinations, permitting anyone to explore and learn about the topic in an iterative fashion. The approach is called permuted experimental designs [10].

Step 3 – Create Self-profiling Classifications, Introduction to the Study for the Respondent, the Rating Question, and the Rating Scale

Step 3 requires the researcher to think about the type of information she or he wants from the respondent. The self-profiling questionnaire allows the researcher to identify WHO the respondent is, and how the respondent THINKS, both of which can be answered directly by the respondent. The researcher describes the topic of the study, presents a rating question. The researcher creates a rating scale, that scale used by the respondent to describe her or his reaction to the vignette. The rating scale or some transformation of the scale will be used in the analysis to link the elements of the vignette to the respondent’s ‘feeling.’

In this study the researchers used a numerical scale, requiring the respondent to select the most appropriate estimate of a minimum wage after reading a vignette (Table 3). The objective was to see how the different elements would drive the dollar value of the minimum wage. This approach, instructing the respondent to estimate the dollar value of an object or experience, has been previously used in a variety of Mind Genomics studies [11,12], and has been given the name ‘Cognitive Economics’ [13,14]. Cognitive economics deals with the responses framed in money, rather than in emotion, a contrast between homo economicus versus homo emotionalis.

Table 3: Questions which the respondents answer to define who the respondent IS, and how the respondent FEELS about the different vignettes presented in the evaluation.

tab 3

Step 4: Execute the Study on the Internet

The Mind Genomics procedure is templated, allowing the researcher to follow a series of steps from the creation of the study to its actual implementation. Once the study has been set up in the template, the BimiLeap program requests the researcher to specify the nature of the respondents, including age, gender, education, geography, and so forth. With today’s reach of the Internet finding respondents is straightforward, and in the interests of time preferable to getting volunteers from one’s pool of acquaintances. The study reported here requested 100 respondents, half males, half females, ages 15-21, provided by Luc.id. The 100 respondents were reduced to 78, based upon incomplete data or incorrect qualifications provided by the respondents. The 22 respondents who did not fit were eliminated at the start of the analysis, before any effort was made to analyze the results. It is important to note that a second wave of respondents could have been recruited, but the objective was met with 78 respondents. Finally, the entire effort to set up the study, including Idea Coach, required about 45 minutes, and the field effort took about 2.5 hours from launch to completion. It is this speed and simplicity of process which makes working with an online panel supplier so attractive for both the student researcher and the professional researcher alike.

The field execution required approximately 3-5 minutes for a respondent, from the time the respondent agreed to participate, pressed the link and began, to the time that the session completed. The respondents were members of various online panels in the United State, the country chosen for the study. The respondents were selected to be no older than 21 years. Qualifying respondents were sent an email invitation, the invitation containing the link.

Those respondents who agreed to participate were asked to complete the self-profiling questionnaire, then read the orientation, and finally evaluated the 24 vignettes. The rating scale was a set of dollar values corresponding to the hourly minimum wage. The five wages were set up in increasing order, although in other studies it is often the case that the five rating values (viz., minimum wages here) might be presented in random order. In any case, the respondent had no trouble completing the study in approximately 3-5 minutes.

The BimiLeap program recorded the information about the respondent from the self-profiling questionnaire, the order of evaluation of the vignette (from 01-24), the composition of the vignette in a set of 16 columns coded 1 if element were present, 0 if absent, and then the final two columns recording the dollar rating assigned along with the response time. The response time was defined as the number of tenths of seconds elapsing between the time that the vignette appeared on the respondent’s screen and the time that the respondent pressed the appropriate key for the rating. The foregoing format of the data record ensured that the database emerging from the 78 respondents, each evaluating 24 vignettes, was immediately ready for statistical analysis.

Step 5: Create Equations (models) Relating the Presence/Absence of the 16 Elements to the Dollar Value of the Rating Scale

The equation is expressed as Dollar Value = k1(A1) + k2(A2) … k16(D4). The equation does not contain an additive constant, under the assumption that in the absence of elements there is no minimum wage. The foregoing equation is created at both a group level for all individuals in the specific group (e.g., age group, gender, etc.), and at the level of the individual respondent.

Once the data are ready for regression analysis, a further analysis created 78 individual level models relating the presence/absence of the elements and the dollar rating. These 78 models were then submitted to cluster analysis [15], to generate two and then the different groups, clusters or ‘mind-sets’ in the language of Mind Genomics. These mind-sets were defined as groups of individuals who were most similar to each other, based upon the pattern of their coefficients. The cluster program created the index for dissimilarity (1-Pearson Correlation across corresponding elements), and then attempt to minimize the index of dissimilarity within a cluster or mind-set and maximize the same index across the centroids of the two or three mind-sets. The three mind-set-solution was selected because the data seemed to be more interpretable than the data from the two-mind-set solution.

Finally, the BimiLeap program measures the response time, and created an equation relating the presence/absence of the elements to the measured response time. Once again, the equation was estimated without the additive constant, gain for the same reason; without any elements in the vignette, there would be no response. The equation is now stated as: Response Time = k1(A1) + k2(A2)… k16(D4).

Results

The first analysis looks at the data without considering that the elements themselves have cognitive meaning. For this first analysis we compute the average dollar value assigned by each respondent to the set of 24 vignettes, as well as the standard deviation of these t dollar ratings. Figure 1 shows the distribution of the averages and standard deviations across the 78 respondents. For most of the respondents the average dollar value lies between 10$/hour and $15/hour. Of more interest is the standard deviation for the 24 ratings. Low standard deviations suggest that the respondent does not change her or his selection of a minimum wage. These would be the group with standard deviations between 0 and 1, respectively. Moderate to high standard deviations suggest that the respondent is swayed by what she or he reads. There is a small cohort of respondents with standard deviations of 3 or higher.

fig 1

Figure 1: Average rating and standard deviation of ratings for each respondent across the 24 vignettes evaluated by each respondent

Figure 1 represents the type of data that are often obtained in studies. The data themselves are simply points, each point having little ‘cognitive meaning’. The points are responses. The measures, average and standard deviation, tell us something about the respondent, viz., proclivity to assign high versus low dollar values to minimum wage, or likelihood to be swayed by information. Beyond that, however, we know little.

A deeper understanding emerges when the data are subject to OLS regression, to determine the contribution of each of the 16 elements to the dollar value selected for the minimum wage. Each regression analysis incorporates only the data from the relevant group of respondents. The regression analysis provides a deeper understanding of how the respondents integrate the information they read into a selection of minimum. The respondent is presented with 24 vignettes and responds almost ‘automatically’ to each vignette.

Table 4 shows the coefficients for the total panel, gender, age, and then the three mind-sets emerging from the clustering. These coefficients are dollar values. The average coefficient and the standard deviation of the 16 coefficients are shown at the bottom of the table. The table of 16 coefficients is sorted by the value for the Total panel, viz. the estimated coefficient (viz., part-worth dollar value) from the equation for the Total panel, viz., the equation using all 24 vignettes rated by the 78 respondents. All coefficients of 3.6 or higher are shown in shaded cells to call attention to them. These coefficients suggest that the elements are perceived to ‘drive’ a higher minimum wage. The coefficient (viz., part-worth dollar value) of 3.6 was chosen as an arbitrary cutoff-off.

Table 4: Dollar Values of minimum wage attributable to elements in the vignette for subgroups of respondents based upon WHO they are, and their emergent mind-sets from clustering

tab 4

Table 4 suggests a variety of interesting patterns:

  1. For total panel, the two high coefficients feature recommendations to save money.
  2. Save Money: Track your spending and look for areas to cut back.

    Save Money: Track your spending and look for areas to cut back.

  3. Males react more strongly than do females, meaning that they choose higher dollar values. Males respond far more strongly to this element, with a coefficient denoting 90 cents more: Save Money: Cut out unnecessary expenses.
  4. Younger respondents (ages 15-18) respond strongly to statements about money. In contrast, older respondents respond strongly to statements about how to save money. This is an important emergent finding, suggesting different ways of processing information.
  5. Three mind-sets emerged based upon similar patterns of coefficients. Mind Genomics studies again and again show that the greatest differences among comparable groups emerge from clustering people based on their responses to a granular topic. Thus, we should expect to see the largest group to group differences across the three mind-sets, which we do.

Mind=Set 1 feels that the government should do the work, and feels empowered to assign high minimum wages when they read about these wages being actually paid out in Los Angeles and in San Francisco.

How to increase minimum wage: Introduce a living wage ordinance that requires employers to pay a living wage

How to increase minimum wage: Provide tax credits or other incentives to employers who pay a living

How to increase minimum wage: Establish a national minimum wage that is tied to the cost of living wage

Minimum age in your area: $13.25/hour (Los Angeles City minimum wage)

Minimum age in your area: $12.00/hour (San Francisco minimum wage)

Mind-Set 2 feels that it is the job of the individual to make the best of the situation by saving money.

Save Money: Track your spending and look for areas to cut back.

Save Money: Cut out unnecessary expenses.

Save Money: Take advantage of discounts and coupons.

Mind-Set 3 appears to be what one might call penurious and judgmental.

Save Money: Cut out unnecessary expenses.

Minimum wage earnings $7.25/hour x 25 hours/week = $181.25/week or $725/month.

The self-profiling questionnaire at the start of the interview required the respondent to choose an appropriate minimum wage, with eight options, six of which comprised more than 10 respondents, and are thus shown (Table 5). Table 5 shows that the respondents who said that they wanted a higher minimum wage in self-profiling classification ended up generating higher part-worth coefficients for the minimum wage across the different vignettes. The coefficients for this group appear in the right-most column of Table 5. The average estimated dollar value across all 16 elements was $3.90, higher than the average of all the remaining groups.

Table 5: Dollar Values of minimum wage attributable to elements in the vignette for subgroups of respondents based upon their self-stated choice of the minimum wage

tab 5

Response Time as a Measure

The literature of experimental psychology is replete with papers on response time (RT). RT is assumed to reflect underlying psychological processes, with shorter RT’s representing fewer ongoing cognitive processes, and in contrast, longer RT’s representing more ongoing processes [16,17]. The BimiLeap program measures the RT by measuring the time elapsed between the presentation of the vignette and the response to the vignette. The BimiLeap program ‘assumes’ that a reasonable maximum RT for a native English-speaking respondent should be no longer than 9 seconds, and truncates at RT’s so that 9 seconds ends up as the maximum RT.

Table 6 shows the RT for the elements based on respondents as defined by WHO they are, and their mind-sets. Table 7 shows the RT for the elements based upon respondents as they select the appropriate minimum wage through the self-profiling questionnaire. In both tables the elements are sorted by the RT for the total panel. RT’s of 0.8 seconds or higher is shown by shaded cells. These are elements to which the respondent ‘pays more attention’, whether for reasons of interest, difficulty in understanding and so forth. The response time of 0.8 seconds was chosen as a representatively long response time, based upon the experience of author HRM.

Table 6: Estimated response time for each element (row), and each key subgroup (total, gender, age, emergent mindset (column)

tab 6

Table 7: Estimated response time for each element (row), and each key subgroup self-defining the appropriate minimum wage (column)

TAB 7

Table 6 shows that the longest response times are those which tell the respondent what to do, as well as information about the minimum wage in New York and in San Francisco.

Save Money: Track your spending and look for areas to cut back.

Minimum age in your area: $11.25/hour (New York City minimum wage)

Minimum age in your area: $12.00/hour (San Francisco minimum wage)

The shortest response time, not surprisingly, comes from an element which might be considered a ‘throw-away,’ viz., and element which seems to convey nothing but a platitude:

How to increase minimum wage: Introduce a living wage ordinance that requires employers to pay a living wage.

In terms of gender, females show longer RT’s than do males for almost all elements, and thus end up with an average response time of 0.2 seconds longer. Females appear to take the time to read the vignettes more slowly, and presumably more carefully.

The two age groups respond similarly as do the three mind-sets. There are differences between and among the groups, but the differences do not create a meaningful pattern that one can interpret.

When we turn to Table 7, the groups defined by the minimum wage that they self-define at the start of the study, we find no elements which generate consistently long response times.

Discussion and Conclusions

The study originated with the question about minimum wage, specifically whether giving minimum wage information was more persuasive than talking about minimum wage in a discursive manner. The study was designed to determine whether the selected value of the minimum wage could be traced to the specific elements. The underlying experimental design allowed the research to deconstruct the selection of a minimum wage into the contributions of each of four types of information; dollar value of minimum wage in four markets, dollar value of four levels of minimum wage; how to survive on the minimum wage; and what the government should do, respectively.

The important observations are quite simple:

  1. Some messages reach the emotions of the respondent, triggering the selection of a higher minimum wage. These are most likely to be messages about what to do, not informational messages about what is:
  2. Save Money: Track your spending and look for areas to cut back.

    Save Money: Cut out unnecessary expenses.

  3. People pay more attention to the meaning of messages rather than to the amount of money stated in the message. We see first and indirectly when we end up with similar dollar values for two ‘parallel’ statements about minimum wages:
  4. Minimum wage earnings $7.25/hour x 25 hours/week = $181.25/week or $725/month

    Minimum wage earnings: $7.25/hour x 40 hours/week = $290/week or $1,160/month

  5. If there is a pattern between dollar value from the coefficient and stated dollar value in the vignette, then the messages most likely also contains a cognitively meaningful and relevant message. The data below suggest that when we provide information to accompany the dollar value (viz., city) a pattern does emerge. Thus the element presenting Chicago ($8.55 minimum wage) generates the highest coefficient (contribution to minimum wage). The coefficient is 3.5. In contrast, the elements presenting Los Angeles and San Francisco (minimum wages stated as $13.25 and $12.00) end up having the lowest value in the group, coefficients of 3.1 for each.

Minimum age in your area: $8.55/hour (Chicago minimum wage) 3.5

Minimum age in your area: $11.25/hour (New York City minimum wage) 3.2

Minimum age in your area: $13.25/hour (Los Angeles City minimum wage) 3.1

Minimum age in your area: $12.00/hour (San Francisco minimum wage) 3.1

Beyond the specifics of the study is, perhaps, the most important finding of the research effort is the creation of a simple process which makes it easy for students to explore topics of social importance from their point of view, and contribute in a meaningful, serious way to knowledge. The templated Mind Genomics system, featuring Idea Coach empowered by artificial intelligence to help formulate questions and answers, provides a game-like introduction to the world of serious research. Just as important is the ability to ‘test’ the answers through consumer research. Even while having fun and learning, the student can do serious work, and emerge with important results.

There is a structural benefit to the above, the benefit of educating a generation fast, more deeply, at far less cost, and engaging the student by making the student an expert in the topic which is of interest. Rather than requiring years of understanding a topic before one is permitted to do ‘serious research’, the BimiLeap program teaches the student about the topic, allowing the student to use artificial intelligence in order to suggest questions, and provide answers, with answers that can be further explored with real people. At the same time that the student learns about the topic by interacting with artificial intelligence in Idea Coach, the student is encouraged to take an active role, to use the information in an experiment, and by so doing provide new-to-the-world knowledge, and often discoveries. It may be the best of all worlds, a source of learning through Idea Coach, and a template for involved, experiential learning and discovery, with the real opportunity to major, new-to-the-world contributions to a topic as one learns about that topic.

References

  1. Waltman JL (2000) The Politics of the Minimum Wage. University of Illinois Press.
  2. Frank RH, Cartwright E (2010) Microeconomics and behavior (Vol. 8). New York, McGraw-Hill.
  3. Sauer R (2018) The macroeconomics of the minimum wage. Journal of Macroeconomics 56: 89-112.
  4. Palazzolo M, Pattabhiramaiah A (2021) The minimum wage and consumer nutrition. Journal of Marketing Research 58: 845-869.
  5. McCurdy, Thomas (2015) How effective is the minimum wage at supporting the poor? Journal of Political Economy 123: 497-545.
  6. Kaufman BE (2010) Institutional economics and the minimum wage: broadening the theoretical and policy debate. ILR Review 63: 427-453.
  7. Gertner J (2006) What is a living wage? New York Times Magazine, January 15, 2006.
  8. Moskowitz HR (2012) ‘Mind Genomics’: The experimental, inductive science of the ordinary, and its application to aspects of food and feeding. Physiology & behavior 107: 606-613. [crossref]
  9. Porretta S, Gere A, Radványi D, Moskowitz H (2019) Mind Genomics (Conjoint Analysis): The new concept research in the analysis of consumer behaviour and choice. Trends in Food Science & Technology 84: 29-33.
  10. Gofman A, Moskowitz H (2010) Isomorphic permuted experimental designs and their application in conjoint analysis. Journal of Sensory Studies 25: 127-145.
  11. Galanter E, Moskowitz H, Silcher M (2011) People, Preferences and Prices: Sequencing the Economic Genome of the Consumer Mind. Bentham Science Publishers.
  12. Saulo A, Moskowitz V, Gere A, Papajorgji P, Ettinger Lieberman L, et al. (2019) Linking food endorsement labels & messaging to perceived price and emotions. A Mind Genomics® Exploration. Advances in Nutrition and Food Science 5.
  13. Moskowitz H, Moskowitz D (2022) Systematics of communication: Conjoint measurement, Emotions, cognitive economics, and Consumer Mind-sets. Product Innovation Toolbox: A Field Guide to Consumer Understanding and Research 198-244.
  14. Moskowitz H, Rappaport S, Moskowitz D, Porretta S, Velema B, et al. (2017) Product design for bread through mind genomics and cognitive economics. In: Developing New Functional Food and Nutraceutical Products 249-278, Academic Press.
  15. Likas A, Vlassis N, Verbeek JJ (2003) The global k-means clustering algorithm. Pattern Recognition 36: 451-461.
  16. Bassili JN, Fletcher JF (1991) Response-time measurement in survey research a method for CATI and a new look at nonattitudes. Public Opinion Quarterly 55: 331-346.
  17. Yan T, Tourangeau R (2008) Fast times and easy questions: The effects of age, experience and question complexity on web survey response times. Applied Cognitive Psychology 22: 51-68.

Cremaster Myogenenis in the Mouse Gubernaculum and the Effect of Androgen

DOI: 10.31038/PSC.2023311

Abstract

Background/Aim: Cremaster muscle is a specialized skeletal muscle, and its differentiation into mature skeletal muscle is normally delayed until after gubernacular migration to the scrotum. The molecular cues regulating its morphology remain elusive. We examined gene expression and immunofluorescence of known markers expressed in cremaster muscle to determine the effect of androgen blockade.

Methods: Gubernacular cells from wild-type (WT) and androgen receptor knock-out (ARKO) mice were cultured at E17, D0 and D3 (n=3 animals/group/day) and qPCR performed for b-Catenin; Desmin; Myogenin; Ki67; Pax 7; PPAR-g; Myh3; and Androgen receptor (AR). The same age groups were also processed for fluorescent immunohistochemistry, and visualized by confocal microscopy.

Results: Β-Catenin expression at D3 was increased in ARKO compared to control animals, and β-Catenin immunofluorescence demonstrated increased cytoplasmic staining in D3 ARKO animals and displaced in the banding pattern of mature skeletal muscle. Desmin, Myogenin and Ki67 expression were all increased in D3 ARKO compared to control animals.

Conclusions: Blockade of androgen in mice demonstrates increased expression of myogenic proteins at D3. This is consistent with premature maturation of cremaster muscle, which is associated with failed elongation of the gubernaculum, incomplete testicular migration to the scrotum, leading to cryptorchidism.

Keywords

Cryptorchidism, Beta-catenin, Testes, Cremaster muscle

Highlights

  1. What is currently known about this topic?
  2. Androgen controls the second stage of testicular descent. As the testes descend, the cremaster muscle is formed within the gubernacular mesenchyme. Cremaster myogenesis is known to involve the expression of β-Catenin; Desmin; Myogenin; Ki67; Pax 7; PPAR-g; and Myh3.

    1. What new information is contained in this article?

    Androgen seems to delay maturation of cremaster muscle allowing elongation of the gubernaculum and migration of the testis. Androgen receptor knockout animals express markers of muscle maturation earlier than control animals, consistent with premature maturation of the cremaster muscle.

    Introduction

    Testicular descent is vital for fertility and prevention of testicular malignancy. Failed testicular descent is one of the most common genital anomalies, affecting 2-4% of newborn males. The gubernaculum, or genitoinguinal ligament, controls testicular descent and subsequent cremaster formation within it in both rodents and humans. Androgen is the primary hormone that regulates the second stage of testicular descent, the inguinoscrotal phase, where the gubernaculum migrates across the pubic bone to reach the scrotum. This migration phase involves gubernacular remodelling and cremaster muscle formation; however the exact molecular mechanisms controlling this remain unknown [1-5].

    The gubernacular mesenchyme differentiates into the cremaster muscle, which is a specialized skeletal muscle with specialized properties that differ to other skeletal muscles. The most distal portion of the rodent gubernaculum containing more myoblasts than the proximal end, so the gubernaculum can elongate like an embryonic limb bud from a distal growth centre with cremaster development more advanced proximally [6,7]. Gubernacular eversion is an integral part of testicular descent in rodents. Rats treated with the anti-androgen (flutamide) demonstrated smaller cremaster muscle mass and a reduction in the size of the growth centre in the gubernaculum. Androgen receptor knockout (ARKO) mice demonstrate failed gubernacular eversion, and increase in gubernacular cord length with age between E17-D4 [8,9]. Androgen insensitivity in humans also leads to failed gubernacular migration and cremaster development. Although the timing of cremaster muscle development differs between rodents and humans, the basic process is similar and this makes the mouse/rat a suitable model for cremaster myogenesis in humans.

    The aim of this study was to determine if androgen blockade caused altered expression of myogenic markers at e17, d0 and d3 in gubernacular fibroblasts, which form the developing cremaster muscle. In response to androgen, the Wnt pathway is known to control multiple target genes to oversee cell proliferation, differentiation and mesenchymal cell migration, so we tested a number of markers in both wild type and ARKO males, which represent different aspects of cremaster myogenesis. Firstly Ki67, which is known to label proliferating cells. β-catenin and PPAR-γ which have been linked to the canonical Wnt pathway, and Myh3 (embryonic heavy chain skeletal myosin) which is expressed in developing muscle fibres. Desmin is one of the earliest protein markers expressed in somites, initially expressed at low levels and increases in expression as cells near terminal differentiation into myoblasts [10]. Myogenin is expressed in skeletal muscle in late myogenesis. It is a skeletal muscle transcription factor, and is known to turn myoblasts into myotubes [11].

    Materials and Methods

    Animals

    Androgen Receptor Knockout (ARKO) mice (Austin Health, Melbourne, Australia). Genetic modification of the third exon of the androgen receptor gene containing the DNA-binding domain was targeted by the Cre/loxP system to remove 1114bp, rendering the animal completely insensitive to androgens [12]. All experiments were performed with approval from Murdoch Children’s Research Institute animal ethics committee (AEC no. A854). Mice were fed normal chow and housed in an enriched, temperature-controlled environment of 23°C and 44% humidity, with a 14-hour-light and 10-hour-dark cycle. Mice were genotyped (refer to supplementary methods section 1.1) and their sex determined before experimental breeding and down-stream analysis.

    Experimental ARKO Mice

    Females with one copy of the mutation on the AR gene on the X chromosomes (het) were bred with wild-type (WT) males to produce litters containing ARKO males. Pregnant dams were sacrificed and fetuses collected via hysterectomy (n=3 animals/group/day litter matched) at embryonic day 17.5 (vaginal plug=day 0.5), pups at day of birth (D0) and postnatal day 3 (D3). Embryos were removed from the uterus and placed on ice for 15-20 minutes before decapitation, and then the gubernaculum was collected from the embryo and cultured in DMEM media. Gubernacular cells were isolated using trypsin for 30mins, incubated at 37°C and cultured in DMEM as single cell fibroblasts for two weeks until they were 90% confluent. These cells were used for downstream analysis. A further n=3 animals/group/day were collected at e17.5, D0 and D3 and processed for histology and immunohistochemistry.

    Standard Histology

    Pelvis from a fetus/pups (n=3 animals/group/day) were collected at e17.5, D0 and D3 fixed in 4% paraformaldehyde (PFA) at 4°C overnight before being processed through graded alcohols and xylene and embedded in paraffin. Samples were sectioned in the sagittal plane at 5µm and floated on silane-coated slides. Slides were stored at room temperature (RT) for minimum 24 hours before being stained.

    Immunofluorescence

    Specimens were sectioned (5μm) and prepared for immunohistochemistry according a previously described protocol [13]. Antibodies selecting specific stages of differentiation were used, β-Catenin; Desmin; Myogenin; Ki67. Single and double labelling of gubernacular sections occurred with the antibodies described in Table 1.

    Table 1: Primary and secondary antibodies. DAPI: *4’6-Diamidino-2-phenylindole (labels nuclei of all cells)

    Company/Catalogue number

    Raised in/clonality

    Working Con. (vol/vol)

    Primary Antibody
    Anti-PPARg BioVision, 3585BP-50 Mouse/polyclonal

    1/200

    Anti-bCatenin Abcam, ab2365 Rabbit/polyclonal

    1/200

     Myogenin Abcam, ab1835 Mouse/monoclonal

    1/200

     Myh3 DSHB, BF-G6 Mouse/monoclonal

    1/200

     Desmin CST, D93F5 Rabbit/monoclonal

    1/500

     Ki67 Abcam, AB16667 Rabbit/monoclonal

    1/300

     Pax 7 Abcam, 34360 Rabbit/polyclonal

    1/500

    Secondary antibody
     Alexa 488 Life Tech, A21202 Lot #898250 Donkey/mouse

    1/1000

     Alexa FluorÒ 488 Invit/a21206 Lot#93b2 Donkey/rabbit

    1/1000

     Alexa 568 Mol Prob, A-11019 Goat/mouse

    1/1000

     DAPI 454 Invitrogen, D3571 N/A

    1/1000

    Confocal Imaging

    Sections of the mouse pelvis were imaged on the Dragonfly spinning disc confocal microscope and images acquired via the Fusion Software (version 2.0, Andor, Northern Ireland). Primary antibodies along with secondary antibodies (Table 1) and DAPI (4, 6-diamidinophenylindole, 1:5000 in PBS) were used to label all nuclei. Confocal images were captured at 40x and 60x magnification. Laser at 488mm, 637 mm excited the DAPI and Alexa 568, respectively to create merged images, which were edited with Fiji Image J software (version 1.50; LOC1, University of Wisconsin-Madison, Madison, Wisconsin, USA) for colour, brightness, contrast correction and scale-bar inserted.

    Real-Time qPCR

    Total RNA was extracted from the cultured gubernacular fibroblasts of 3 independent ARKO and wild-type males at E17.5, D0 and D3 using the RNeasy mini column (Qiagen, Cat:74104). RNA was treated with DNase I (Qiagen, Cat: 79254) and the concentration was determined using NanoDrop spectrophotometer. Gene expression was measured using 10ng/µl of cDNA by GoTaq qPCR (Promega, Cat: A6001) for real time quantitative polymerase chain reaction (RT-qPCR). Nucleotide sequences (Table 2) were used and the expression was normalised to Rpl32. Rpl32 is a housekeeping gene which enables normalisation for heterogeneity in clinical samples, as well as for variability introduced during RNA extraction and cDNA synthesis [14].

    Statistical analysis was performed using Student’s t-test or ANOVA, as appropriate using GraphPad Prism version 7.04 for Windows (GraphPad Software, San Diego, California USA, www.graphpad.com). Error bars on the graphs are presented as standard error of the mean (SEM). A P-value of <0.05 was considered statistically significant.

    Table 2: Mouse primer sequences

    Gene

    Forward Primer Sequence 5’

    Reverse primer Sequence 5’

    Rpl32

    GAGGTGCTGCTGATGTGC

    GGCGTTGGGATTGGTGACT
    β-catenin

    ACCTTTCAGATGCAGCGACT

    TGGCACACCATCATCTTGTT

    Desmin

    GTGGATGCAGCCACTCTAGC

    TTAGCCGCGATGGTCTCATA

    Mhy3

    ATGGTGGATGTGGAAAGAGC

    CCGTTTCACGGTTTCAAGTT

    Myogenin

    ACTCCCTTACGTCCATCGTG

    CAGGACAGCCCCACTTAAAA

    PPAR-γ

    GTCACACTCTGACAGGAGCC

    TCACCGCTTCTTTCAAATCT

    Ki67

    GACAGCTTCCAAAGCTCACC

    TGTGTCCTTAGCTGCCTCCT

    Pax 7

    GGAAAACCAGTGTGCCATCT

    CCTTGTCTTTGGCACCATTT

    Results

    β-Catenin Expression in ARKO and Control Animals

    In the cultured gubernacular fibroblasts, β-catenin expression was not significantly altered in e17.5 and D0 ARKO animals compared to WT. By contrast, β-catenin expression was upregulated in D3 ARKO fibroblasts, compared to the WT male counterpart (P=0.0003) (Figure 1A).

    β-Catenin Immunoreactivity in D3 ARKO and Control Animals

    Immunofluorescence of the gubernaculum in D3 ARKO and control animals showed differing patterns of staining (Figure 2A). Control animals showed staining throughout the cell cytoplasm, with cell membrane staining as well. ARKO animals showed staining throughout the cytoplasm with displacement into bands, consistent with myotube formation.

    Desmin, Myogenin and Ki67 Expression and Immunoreactivity in ARKO and Control Animals

    In the cultured gubernaculum; Mhy3 expression was upregulated in D0 ARKO animals, compared to the WT male counterpart (P < 0.0001) (Figure 1B). Immunofluorescence at D0 confirmed this, with decreased fluorescence in the wild type animal compared to the ARKO (Figure 2B). PPAR-γ expression was upregulated in ARKO males at D0 compared to WT male counterpart (p=0.022) (Figure 1C). Immunofluorescence at D0 confirmed this (results not shown). Desmin expression was upregulated in D0 ARKO and D3 ARKO animals, compared to the WT male counterpart (P=0.0242, P=0.05) (Figure 1D). Immunofluorescence at D3 confirmed this (results not shown). Myogenin expression was upregulated in ARKO males at D3, compared to WT male (P=0.05) (Figure 1E). Immunofluorescence at D3 confirmed this, with less fluorescence in wild type animals compared to ARKO (Figure 2C). Ki67 expression was upregulated in D3 ARKO animals, compared to the WT male counterpart (P=0.05) (Figure 1F). Immunofluorescence at D3 confirmed this, with less fluorescence in wild type animals compared to ARKO animals (Figure 2D).

    fig 1

    Figure 1: Real-Time qPCR was used to demonstrate gene expression changes in WT (black bar) and ARKO (grey bar) animals at e17.5, birth (day 0), and day 3 postnatal. (A) βCatenin expression (B) Mhy3 expression (C) Ppary expression (D) Desmin expression (E) Myogenin expression (F) Ki67 expression.

    fig 2

    Figure 2: Immunofluorescent labelling in the gubernaculum of wild-type and ARKO animals, blue is DAPI. Scale bar equals 100 mm (imaged with 60x oil magnification). (A) β-Catenin (green) at day 3 in the wild type and ARKO animals. (B) Mhy3 (green) at day 0 wild type and ARKO. (C) Myogenin (green) at day 3 (D) Ki67 (green) at day 3 in wild-type and ARKO animals.

    Discussion

    The results of this study indicate that fibroblasts cultured from the developing mouse cremaster muscle express more β-catenin at D3 in androgen receptor blockaded animals, and the pattern of immunoreactivity in ARKO animals is different from WT. ARKO animals demonstrated ‘banding’, presumably from myotubes developing skeletal muscle striation and displacing cytoplasm. ARKO animals also demonstrate increased expression of Mhy3 and PPAR-γ at D0, and Desmin, Myogenin and Ki67 at D3 compared to WT animals.

    At the onset of rodent inguinoscrotal testicular descent, the gubernaculum is a solid pyramidal structure of mesenchyme which everts from the abdominal cavity through the nascent inguinal canal to form a hollow cone lined by the future processus vaginalis mesothelium [6]. The solid mesenchymatous gubernacular tip is an undifferentiated ‘growth centre’ which has similar properties to an embryonic limb bud [15]. As the gubernaculum elongates to the scrotum the primitive fibroblasts differentiate into myoblasts and then eventually to mature muscle [16,17].

    These results suggest that androgen signalling is critical in allowing the cremaster differentiation to be delayed long enough to allow gubernacular eversion, as mature skeletal muscle may be too stiff to permit the radical remodelling required. The increased β-catenin expression by D3 is consistent with more mature muscle formation in the ARKO gubernaculum, and the situation seen in the cytoplasm shows what appears to be much more advanced development of skeletal cremaster muscle. By contrast, in the WT gubernaculum, there is no striated pattern of β-catenin, consistent with less advanced cremaster skeletal muscle differentiation, until migration is complete.

    The increased expression of Myh3 at D0, as well as PPAR-γ and desmin on D0, also suggest early differentiation into skeletal in the ARKO gubernaculum when in WT animals expression of these early markers of muscle development are much lower. The significant increase in myogenin expression at D3, a marker of later muscle development, is consistent with rapid differentiation of fibroblasts into mature cremaster muscle without androgen signalling, which is prevented in the WT mouse. The increased expression of Ki67 in D3 ARKO gubernacular fibroblasts is of uncertain significance, as in vivo the gubernaculum fails to migrate and remains bulky with persistence of hydrophilic extracellular matrix, and eventually undergoes metaplasia into adipose tissue [18]. These findings indicate the cremaster muscle behaves differently from other sexually dimorphic skeletal muscle in which AR signalling accelerates differentiation [19].

    The cremaster is a specialised skeletal muscle that has some properties alike cardiac and smooth muscle. The cremaster is not under conscious control, and responds to temperature and touch, as in the cremaster reflex. It’s different response to androgen stimulation is consistent with its different formation and physiological properties. Cremaster muscle myogenesis has been examined in the human fetus and is thought to have some smooth muscle characteristics [20].

    Historically, the cremaster muscle was thought to form passively by the gubernaculum collecting fibres from the internal oblique muscle as the testis descended past the internal inguinal ring. We now know androgen actively governs gubernacular growth and cremasteric development, during the window of androgen sensitivity, between E15-E19 of the rat embryo [21]. Androgen acts both directly and indirectly on the gubernaculum [22]; indirectly by causing the genitofemoral nerve (GFN) to release calcitonin gene-related peptide (CGRP), a known neuropeptide, which regulates gubernacular migration; and later directly by androgen receptors in the gubernaculum itself. We know that gubernacular eversion is a key aspect of testicular descent in rodents, and gubernacular eversion fails in androgen blockaded/ or knock out models. Despite the relative anatomical simplicity which occurs during gubernacular eversion, the effect of androgen on the linked molecular pathways remains complex.

    Androgen stimulation during inguinoscrotal descent has been linked to the canonical Wnt pathway and beta-catenin (β-catenin). β-catenin either binds to the androgen receptor and moves into the cell nucleus where it acts as a potent co-activator of the androgen receptor/ androgen receptor-positive genes; or it binds to the T-cell factor to promote activation of the Wnt-responsive genes [23]. In rats, it has been hypothesized that the interaction between androgen and β-catenin may be a necessary step in the digestion of collagen by androgen receptor-positive cells, assisting with cell migration from the core of the gubernaculum and enabling gubernacular eversion [24]. With androgen interacting with Wnt proteins, allowing nuclear translocation of β-catenin, androgen blockade leads to β-catenin accumulating in the cytoplasm and reduced myogenic proteins, thus myogenic gene transcription is necessary before gubernacular eversion and migration towards the scrotum. A conditional knockdown of β-catenin caused failure of CM myogenesis resulting in an intrabdominal testis [25]. Research using microarray analysis has suggested that Wnt signalling, working in conjunction with androgen receptor, may contribute to CM formation and testicular descent, as a defect in the Wnt signalling pathway and AR both produced intra-abdominal testis, which is a phenotype commonly associated with patients presenting with complete androgen insensitivity syndrome [26].

    Peroxisome proliferator-activated receptors (PPAR) also have been linked to the canonical Wnt pathway. PPAR’s are nuclear receptors that belong to the nuclear hormone superfamily and they share similar structural features with other nuclear receptors, such as androgen receptors (AR). PPAR-γ expression is critical for differentiation of rat skeletal muscle in vivo [27], and has also been linked to slow twitch skeletal muscle fibres known to be present in cremaster muscle. PPARs act as ligand-activated transcription factors which regulate gene expression by binding onto the Retinoid X Receptor (RXR), and specific regions of DNA sequence elements termed PPAR Elements (PPARE) in promoter regions of target genes, to modulate transcription. While the full range of PPAR ligands is not yet known, they are usually fatty acids or their derivatives. PPAR-γ may also interact with Beta (β)-catenin, a cytokine which has already been linked to testicular descent and cremaster development. b-catenin is thought to enhance PPAR-γ activity, leading to specific target gene activity. PPAR-γ has not been linked to cremaster myogenesis and the gubernaculum previously.

    The appropriateness of the mouse gubernaculum model to investigate cremaster development in humans is debated. Certainly, the anatomy of the cremaster muscle is different, with the rodent muscle forming a bi-laminar sac around the process vaginalis, while in the human it is just a strip [28]. However in both rodents and humans remodelling of the gubernacular mesenchyme is similar, except for timing, and cremaster develops within the gubernaculum itself. In both species androgen resistance prevents gubernacular migration and normal cremaster muscle development. We propose that once the difference in timing and cremaster development are taken into account, we can then extrapolate the results of this to suggest that, not only in the rodent but also in the human, androgen blockade may trigger premature differentiation of embryonic myoblasts in the gubernaculum, which may interfere with gubernacular eversion and/or elongation. Maintaining the cremaster myoblasts in a less differentiated state may allow the gubernaculum to elongate and migrate from the external inguinal ring to the scrotum in both species. Once terminal differentiation into mature muscle fibres has occurred, further elongation of the cremaster muscle within the gubernaculum is likely to be impaired. These alterations in muscle-related genes have also been detected in rat strains with inherited cryptorchidism and in anti-androgen-treated rats [29]. This is consistent with morphological changes showing disorganised abnormal striated cremaster muscle in cryptorchid rodents.

    The main limitation of this work is the small number of animals used, and that only 3 time points were studied. However, the consistency between the immunofluorescence and the gene expression results suggest that these limitations were not critical.

    Conclusion

    Testicular descent requires delayed development of cremasteric muscle; allowing migration of the testis into the scrotum. In the absence of AR, gubernacular mesenchymal cells prematurely develop into myoblasts prior to cremaster muscle differentiation.

    This study suggests that in the wild-type mouse, cremaster muscle maturation is usually delayed at the myoblast stage allowing eversion of the gubernaculum around D0 and then elongation to the scrotum. This study is consistent with AR blockade producing premature maturation which would inhibit eversion and gubernacular migration. We propose that undescended testes could be due to the premature maturation of cremaster muscle in AR-blockaded animals which prematurely halts the eversion and movement of the gubernaculum towards the scrotum. It is possible that defects in the response to androgen stimulation in the Wnt, b-catenin and PPAR signalling pathways may lead to cryptorchidism in boys without androgen resistance. These intracellular signalling systems should be included in future searches for the causes of cryptorchidism using modern genetic analysis.

    Funding

    NHMRC grant APP1144752.

    Disclosures and Declaration of Interests

    None

    Human Ethical Approval

    Murdoch Children’s Research Institute Animal Ethics Committee AEC no. A854.

    References

      1. Hutson JM, Balic A, Nation T, Southwell B (2010) Cryptorchidism. Seminars in Pediatric Surgery 19: 215-24.
      2. Hutson JM, Hasthorpe S, Heyns CF (1997) Anatomical and functional aspects of testicular descent and cryptorchidism. Endocrine Reviews 18: 259-80. [crossref]
      3. Hutson JM (1985) A biphasic model for the hormonal control of testicular descent. Lancet 2: 419-21. [crossref]
      4. Favorito LA, Costa SF, Julio-Junior HR, Sampaio FJ (2014) The importance of the gubernaculum in testicular migration during the human fetal period. International Braz J Urol: Official Journal of the Brazilian Society of Urology 40: 722-9. [crossref]
      5. Costa WS, Sampaio FJ, Favorito LA, Cardoso LE (2002) Testicular migration: remodeling of connective tissue and muscle cells in human gubernaculum testis. J Urol 167: 2171-6. [crossref]
      6. Harnaen EJ, Na AF, Shenker NS, et al. (2007) The anatomy of the cremaster muscle during inguinoscrotal testicular descent in the rat. Journal of Pediatric Surgery 42: 1982-7
      7. Churchill JA, Buraundi S, Farmer PJ, et al. (2011) Gubernaculum as icebreaker: do matrix metalloproteinases in rodent gubernaculum and inguinal fat pad permit testicular descent? Journal of Pediatric Surgery 46: 2353-7
      8. Nation TR, Buraundi S, Balic A, et al. (2011) The effect of flutamide on expression of androgen and estrogen receptors in the gubernaculum and surrounding structures during testicular descent. Journal of Pediatric Surgery 46: 2358-62. [crossref]
      9. Perera N, Szarek M, Vannitamby A, et al. (2018) An immunohistochemical analysis of the effects of androgen receptor knock out on gubernacular differentiation in the mouse. Journal of Pediatric Surgery 53: 1776-80. [crossref]
      10. Li Z, Marchand P, Humbert J, Babinet C, Paulin D (1993) Desmin sequence elements regulating skeletal muscle-specific expression in transgenic mice. Development (Cambridge, England) 117: 947-59. [crossref]
      11. Faralli H, Dilworth FJ (2012) Turning on myogenin in muscle: a paradigm for understanding mechanisms of tissue-specific gene expression. Comparative and Functional Genomics 2012: 836374. [crossref]
      12. Notini AJ, Davey RA, McManus JF, Bate KL, Zajac JD (2005) Genomic actions of the androgen receptor are required for normal male sexual differentiation in a mouse model. Journal of Molecular Endocrinology 35: 547-55.
      13. Vikraman J, Sarila G, O’Conner L, Menheniott T, Hutson JM (2022) BDNF is upregulated by androgen in the inguinal fat pad of immature mice and may regulate inguinoscrotal testicular descent. Pediatric Research 91: 846-52. [crossref]
      14. Kriegova E, Arakelyan A, Fillerova R, et al. (2008) PSMB2 and RPL32 are suitable denominators to normalize gene expression profiles in bronchoalveolar cells. BMC Molecular Biology 9: 69.
      15. Sanders N, Buraundi S, Balic A, Southwell BR, Hutson JM (2011) Cremaster muscle myogenesis in the tip of the rat gubernaculum supports active gubernacular elongation during inguinoscrotal testicular descent. J Urol 186: 1606-13. [crossref]
      16. Lie G, Hutson JM (2011) The role of cremaster muscle in testicular descent in humans and animal models. Pediatric Surgery International 27: 1255-65. [crossref]
      17. Szarek M, Li R, Vikraman J, Southwell B, Hutson JM (2014) Molecular signals governing cremaster muscle development: clues for cryptorchidism. Journal of Pediatric Surgery 49: 312-6.
      18. Griffiths AL, Momose Y, Hutson JM (1993) The gubernaculum in adult female, adult male and TFM male mice. International Journal of Andrology 16: 380-4. [crossref]
      19. Lee DK (2002) Androgen receptor enhances myogenin expression and accelerates differentiation. Biochemical and Biophysical Research Communications 294: 408-13. [crossref]
      20. Tanyel FC, Talim B, Atilla P, Müftüoğlu S, Kale G (2005) Myogenesis within the human gubernaculum: histological and immunohistochemical evaluation. European Journal of Pediatric Surgery: Official Journal of Austrian Association of Pediatric Surgery 15: 175-9.
      21. Welsh M, Saunders PT, Fisken M, et al. (2008) Identification in rats of a programming window for reproductive tract masculinization, disruption of which leads to hypospadias and cryptorchidism. The Journal of Clinical Investigation 118: 1479-90. [crossref]
      22. Schwindt B, Farmer PJ, Watts LM, Hrabovszky Z, Hutson JM (1999) Localization of calcitonin gene-related peptide within the genitofemoral nerve in immature rats. Journal of Pediatric Surgery 34: 986-91. [crossref]
      23. Sarila G, Hutson JM, Vikraman J (2022) Testicular descent: A review of a complex, multistaged process to identify potential hidden causes of UDT. Journal of Pediatric Surgery 57: 479-87. [crossref]
      24. Choi HY, Lim JE, Hong JH (2010) Curcumin interrupts the interaction between the androgen receptor and Wnt/β-catenin signaling pathway in LNCaP prostate cancer cells. Prostate Cancer and Prostatic Diseases 13: 343-9.
      25. Kaftanovskaya EM, Feng S, Huang Z, et al. (2011) Suppression of insulin-like3 receptor reveals the role of β-catenin and Notch signaling in gubernaculum development. Molecular Endocrinology (Baltimore, Md) 25: 170-83. [crossref]
      26. Hughes IA, Davies JD, Bunch TI, Pasterski V, Mastroyannopoulou K et al. (2012) Androgen insensitivity syndrome. Lancet 380: 1419-28.
      27. Singh J, Verma NK, Kansagra SM, Kate BN, Dey CS (2007) Altered PPARgamma expression inhibits myogenic differentiation in C2C12 skeletal muscle cells. Molecular and Cellular Biochemistry 294: 163-71. [crossref]
      28. Hutson JM, Baskin LS, Risbridger G, Cunha GR (2014) The power and perils of animal models with urogenital anomalies: handle with care. Journal of Pediatric Urology 10: 699-705. [crossref]
      29. Barthold JS, McCahan SM, Singh AV, et al. (2008) Altered expression of muscle- and cytoskeleton-related genes in a rat strain with inherited cryptorchidism. Journal of Andrology 29: 352-66. [crossref]

Therapeutic Effect and Safety of Rectal Ozone Therapy in Mild and Moderate Symptomatic SARS CoV-2 Positive Patients

DOI: 10.31038/JNNC.2022514

Abstract

Background: COVID-19 an infectious disease caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Ozone therapy would be a therapeutic option for COVID- 19. Objective: To explore therapeutic effect and safety of rectal ozone therapy in mild and moderate symptomatic SARSCoV-2 positive patients, is the purpose of this study.

Methods: An exploratory, controlled, open and monocentric study was carried out in 32 patients, distributed at random in two groups of 16 patients each. The first group received rectal ozone therapy (ROT) with Standard treatment (ST) and the second one only ST. ROT were applied every 12 h for 10 days. Patients aged 19-80 years were included, after signing the informed consent, with positive SARS-CoV 2 symptomatic. RT-PCR and clinical signs evolution were primary efficacy variables. Ferritin, C-reactive protein, oxidative stress biomarkers, inflammatory cellular indicators, and biochemical and hematological variables.

Results: Patients (81%) had negative RT-PCR after ROT tenth application, with significant differences to ST group (43%). ROT significantly increases Glutation (GSH) levels compared to ST group, but not other REDOX markers as SOD, MDA, ON and AOPP. Catalase activity increased in both groups.

Conclusion: This study demonstrates the efficacy and safety of ROT in both mild and moderate symptomatic SARS-CoV 2 positive patients.

Keywords

COVID 19, SARS CoV-2, Rectal Ozonetherapy, REDOX Balance, Superoxide dismutase, Glutation

Introduction

COVID-19 is the third known zoonotic coronavirus disease after Acute Respiratory Response Syndrome (SARS) and Middle Eastern Respiratory Syndrome (MERS-CoV), which also originates from the β cluster –coronavirus [1].

Among the complexities of the pathophysiological process of this viral infection, the so-called “storm of decompensated cytokines” stands out, which damage the vascular system, causing activation of the coagulation system, the consequent formation of thrombosis, which prevents perfusion into the tissues, causes multiple organ failure and death of patients [2].

The generation of free radicals is one of the pathogenic mechanisms of viruses, to cause inflammation and tissue damage. Oxidative stress is induced after the virus enters the host cell to facilitate its replication [3]. This suggests that the use of immunomodulatory and stimulatory therapeutic forms of the endogenous antioxidant response, such as ozone therapy, could counteract the pathophysiological development of COVID 19.

Several therapeutic effects justify the use of ozone in COVID-19 patients [4]. Ozone therapy stimulates Nrf2 [5,6], that would be an important physiological mechanism to blocked virus (SARS CoV 2) replication endogenously, preventing receptor contact to the virus, by reducing the expression of ACE2 and TMPRSS2, inactivating the virus replication ability [7]. The rebalancing of REDOX state achieved with ozone therapy is also important to cytokine synthesis induction by monocytes and lymphocytes, heme-oxygenase (HO-1) and shock proteins release, which are powerful activators of the immune system [8,9].

The immunomodulatory action of inflammatory response mediated by pro-inflammatory cytokines and increase in endogenous antioxidant activity, accompanied by the increase in nuclear transcription factor Nrf2 (5), by ozone therapy, was demonstrated in both preclinical [10-14] and clinical chronic pathological processes [15,16].

The rectal ozone therapy efficacy and safety was studied in 12 clinical trials, including chronic pathologies (angiopathy, chronic inflammation, immune imbalances, chronic rheumatological inflammation, among others), reaching improvement in both clinical and biochemical parameters, without adverse effects, only in one clinical trial mild irritation was evidenced in two patients [17].

Recently, the ozone therapy benefits applied by MAHT as adjuvant treatment in severe patients with COVID-19 have been demonstrated in different countries such as China [18], Italy [19,20] and Spain [21]. On the other hand, rectal ozone therapy insufflation also demonstrated its benefits in severe COVID 19 patients [22,23].

Due to all these antecedents of ozone therapy and the eminent need to provide a therapeutic solution to this COVID- 19 disease, the objective is to explore the therapeutic effect and safety of rectal ozone therapy in both mild and moderate symptomatic SARS-CoV 2 positive patients.

Materials and Methods

Study Design

The study was conducted following the ethical principles reflected in the 2013 Helsinki declarations and WHO recommendations. The exploratory study was an open-label and randomized trial. The study was conducted from May to August 2020 and the Hospital Health Care Ethics Committee authorized the study and ozone treatment. Positive confirmed COVID 19 patients, hospitalized in “Salvador Allende” Hospital, La Habana, Cuba were recruited for the study. Eligibility criteria for the study were the age and positively tested COVID 19 at least for 48 h later. The institutional review board of the hospital, Cuban Ministry of Public Health (MINSAP) and the Cuban Regulatory Agency (CECMED) approved this study and registered in the clinical trials public register with the number: RPCEC 0000320.

Inclusion Criteria

Adults of age 19 to 80 from both sex with positive reverse transcription-polymerase chain reaction (RT-PCR) from the nasopharyngeal swab test result, presenting mild to moderate clinical signs and willing were included in the study. All hospitalized patients included were informed of the procedures and potential risks and gave written informed consent.

Exclusion Criteria

1) Pregnancy or lactation; 2) G-6PD (glucose 6-phosphate dehydrogenase) deficiency (favism); 3) Patients with uncontrolled hyperthyroidism, 4) patients with abnormal coagulation, thrombocytopenic and active bleeding. 5) Allergic or intolerance to ozone. 6) Patients that use immunosuppressive medication. 7) Patients participating in another clinical trial. 8) Patients with psychiatric diseases. 9) Patients suffering from uncontrolled chronic disease.

Groups

We screened 32 patients positive SARS-CoV 2, confirmed by RT-PCR and hospitalized in the “Salvador Allende Hospital”. Patients were randomly assigned to two groups of 16 patients each. Randomized treatment was open-label. Patients were assigned to a serial number by the study coordinator. Each serial number is linked to a computer-generated randomization list assigning the treatment regimens. The first group received rectal ozone therapy combined with standard treatment (Ozone + standard treatment (ST) and the second group with ST, where the patients were provided with conventional care as recommended in clinical management protocol for COVID 19 advocated by MINSAP.

Ozone Rectal insufflation

Medical Ozone obtained by Ozomed Plus®, (Ozone Generator) National Centre for Scientific Research, BioCubaFarma, Habana, Cuba. For rectal administration, the patients were placed in lateral decubitus position with lower limbs flexed and then lubricated rectal catheter was introduced rectally with patient’s collaboration. A hemostatic clamp was placed on the catheter before the gas was insufflated. Ozone from the generator and immediately insufflated through the catheter, after removing the hemostat clamp. The insufflation time will be a few minutes, at an administration rate of 1 ml/s. The Ozone therapy rectal insuflation schedule was the following described in TS1.

Standard Treatment (ST) Approved by MINSAP Protocol for COVID-19, Version 1.4

-Kaletra ® (Capsules 200 mg lopinavir + 50 mg ritonavir) Medsol, Havana, Cuba.

-Chloroquine (Tablets 250 mg), one every 12 h, for 10 days.

-Heberferon® (Interferon α-2b human recombinant + interferon-gamma human recombinant 3,5 M UI Ampoule (lyophilized)) according to the National Formulary, IM, three times a week. Heber Biotec, S.A. Havana, Cuba

-Ceftriaxone one bulb every 12 h during 10 days, in the cases with pulmonary infection diagnostic.

Analysis of Primary Efficacy Parameters

The primary endpoint in this study was the patient’s percentage having negative RT-PCR test for SARS-CoV-2 in nasopharyngeal swab samples on 5th and 10th treatments. A global response was considered too, where RT-PCR and clinical signs are classified into the complete response if RT-PCR test was negative and clinical signs disappear; partial response if RT-PCR was negative and clinical symptoms presented at inclusion time did not worsen or disappear at least two of them and non-response, if RT-PCR was still positive, regardless of clinical signs.

Secondary variables are C-reactive protein (CRP), neutrophil/lymphocytes ratio and redox parameters. The secondary variables were determined at the initial and after the 5th day of treatment. A high percentage of patients have a negative PCR on the fifth day and were discharged, for that reason most of the evaluations were made on the fifth day and not on the tenth day.

All redox parameters were determined in serum by spectrophotometric methods using Zuzi Spectrophotometer (Japan). Serum reduced glutathiones (GSH) concentrations were measured by kinetics assay using the glutathione reductase reaction [24]. Malondialdehyde (MDA) concentrations were analyzed with the LPO-586 kit obtained from Calbiochem (La Jolla, C.A., USA) [25]. Superoxide dismutase (SOD) activities were assayed by a modified pyrogallol autoxidation method [26]. Catalase (CAT) activity was measured according to the method of Claiborne [27]. Serum advanced oxidation protein products (AOPP) was measured according to the methods of Witko-Sarsat et al, 1998 [28]. Nitrates and nitrites relation (NO) levels were measured according to Griess methods described by Granger et al 1996 [29].

Blood parameters such as hematocrit, hemoglobin, and erythrocyte sedimentation rate, were screened by Hematological counter MICROS 60. Others as triglycerides, creatinine, cholesterol and alanine aminotransferase activity were performed by standard procedures in HITACHI analyzer 912. As an efficacy response, the values of hemoglobin, hematocrit, erythrocytes, leukocytes, platelets and differential of leukocytes (lymphocytes, monocytes, basophils, neutrophils and eosinophils), erythrocyte sedimentation were considered to normalize. Also as an efficacy response, the values of albumin, lactate dehydrogenase (LDH), alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatinine (Cr), gamma-glutamyl transferase (GGT), glucose, creatinine, bilirubin, uric acid (AU), cholesterol, triglyceride, and high-density lipoproteins (HDL) were considered to remain within their normal values. The safety and tolerability were evaluated through complementary variables (hemogram and blood chemistry). Analysis of adverse reactions occurrence was included too. In addition, a subjective assessment of tolerability was performed, according to following categories: Very good (no adverse events-AE), Good (mild and transient AE), Fair (moderate AE), Poor (severe AE) [30-53].

Statistical Analysis

For the evaluation of the response, the proportions of response by groups were estimated for the main variables (a negative RT-PCR test and the evolution of the clinical signs). The groups were compared using Fisher’s exact test. This analysis was carried out for the variable “global response” according to the success criteria defined in the protocol. For the secondary variables (laboratory variables) were compared at times 5 and 10 days with respect to baseline using the paired t-test (before-after) or the Wilcoxon signed-rank test, as appropriate.

Results

With respect to baseline characteristics of the 32 patients included in the study there were no statistical differences, between the groups according to demographics, gender and age of patients (p˃0.05), except for comorbidities risk which was high in the Ozone group (87%) in comparison to 68,8% for the control group (p=0.0021). Regarding clinical symptoms classification (mild and moderate), the ozone group had 50% for both mild and moderate symptoms, however, the control group had 69% mild symptoms patients and 31% with moderate symptoms, which showed significant differences between both groups (p=0.0236).

After the fifth day of ozone therapy treatment, 81% of patients had a negative RT-PCR, with significant differences (p=0.01) compared to the control group (43%). After 10 days of treatment, 93.8% of patients showed a negative RT-PCR in the ozone group, with significant differences (p=0.01) with regards to the control group (62.5%) (Table 1).

Table 1: RT-PCR SARS CoV 2 analysis in swab samples from each group

Immunological response

RT-PCR

Ozone

Control

5th day Negative

13 (81.3%)

7 (43.8%)**

Positive

3 (18.8%)

9 (56.3%)

10th day Negative

15 (93.8%)

10 (62.5%)**

Positive

1 (6.3%)

6 (37.5%)

**Pearson’s chi-squared test

The severity of clinical symptoms and signs improved significantly after 5 days of treatment in ozone group, compared to control group (p<0.05), without differences at 10 days of treatment (Table 2). Regarding global response, there were significant differences for total, partial and non-response between groups. In the ozone group, the percentage of patients who had a total response (25%) increased significantly (p˂0.05) compared to the control group (0%) after 5 days of treatment. Furthermore, 56. 3% of patients from control group had non-response on the fifth day, compared to ozone group (18.8%) (p<0.05). After 10 days, the results were similar, in ozone group increased significantly (p<0.05) the patient percentage (37.5%) with a total response with regards to control group (12.5%) (Table 2).

Table 2: Disease evolution according to clinical symptoms and signs and global response to treatments

 

5th day

10th day

 

Ozone

Control

Ozone

Control

Disease evolution according to clinical symptoms and signs+, n patients (%)
Improved severity of the disease

7 (43.8%)

1 (6.3%)*

7 (43.8%)

3 (18.8%)

Global Response to treatments, n patients (%)
Total

4 (25.0%)

0 (0%)*

6 (37.5%)

2 (12.5%)*

Partial

9 (56.3%)

7 (43.8%)

10 (62.5%)

9 (56.3%)

Non-reponse

3 (18.8%)

9 (56.3%)*

0 (0.0%)

5 (31.3%)*

+Symptoms and signs: fever, headache, fatigue, sore throat and dry cough. *p˂0.05 comparing both groups Fisher exact test.

Ozone and control, showed a reduction in the levels of C reactive proteins after 5 days of treatment, but only was significant (p<0.05) for the control group. Regarding related indicators, such as neutrophil/lymphocyte ratio (N/L R), both groups experience a reduction of N/L R on the 5th day of treatment. However, only the ozone group achieved a statistically significant reduction (p<0.05) from 2.5 to 1.5 mg/L (Table 3).

Table 3: Inflammation variables

Groups

Baseline

5th day

C reactive protein mg/L (reference < 6)
Ozone

17.8 ± 22.7

 9.0 ± 11.4

Control

10.7 ± 16.2

 5.1 ± 6.6**

N/L R
Ozone

2.5 ± 1.5

1.5 ± 0.9**

Control

2.3 ± 1.4

1.6 ± 1.0

**Comparison within groups (before and after) Wilcoxon signed-rank test.
N/L R: neutrophil /lymphocytes ratio.

The behavior of the Redox state, shown by the values of antioxidant indicators (levels of glutathione and activity of CAT and SOD) and pro-oxidants (AOPP, MDA and NO), are shown in Table 4, for each group, at the beginning (baseline) and at 5 days after starting the treatments. Both groups began the study with similar GSH values, without significant differences between them. The group of patients that received treatment with rectal ozone showed a significant increase (p=0.025) in GSH levels on the fifth day of treatment. However, the control group did not experience significant changes on the fifth day with regards to the initial value. On the other hand, both groups show significant differences (p=0.009) between them on the fifth day after starting the study. Regarding CAT activity, both groups show significant increase (p=0.001) on the fifth day of treatment in comparison to the baseline value, without significant differences between the groups. SOD activity did not reveal significant changes between groups. The pro-oxidant indicators (AOPP, NO and MDA) did not reach significant changes in any of the study groups.

Table 4: The behavior of the REDOX indicators for each of the groups

Variables

Ozone

Control

Baseline

5th day

Baseline

5th day

GSH (mmol/mg Hb)

448.1 ± 105.2

511.7 ± 58.3*+

424.0 ± 72.2

398.6 ± 68.7

CAT (U/mg Hb min)

266.4 ± 47.6

302.2 ± 47.8*

223.4 ± 35.6

257.6 ± 39.3*

SOD ((U/mg Hb min )

3.01 ± 0.6

3.23 ± 0.4

2.27 ± 0.4

2.77 ± 0.4

AOPP (µM/cloramina T

20.6 ± 1.8

20.7 ± 2.7

21.66 ± 1.5

21.88 ± 2.7

NO ([NO2] μM)

31.3 ± 4.8

31.7 ± 7.4

33.3 ± 9.4

40.7 ± 19.0

MDA (mmol/mg Hb)

3.3 ± 0.6

3.2 ± 0.6

3.0 ± 0.4

2.9 ± 0.5

SD: standard deviation, CAT: catalase, SOD: superoxide dismutase, MDA: malondialdehyde, GSH: glutathione, AOPP: advanced oxidation protein product. +Compare between groups and *p<0.05 differences between the baseline and the 5th day, by t student test or Wilcoxon test.

The hematological indicators evaluated did not show differences between groups at the evaluation times (baseline and the fifth day) except for the percentage of neutrophils and lymphocytes, where in both groups, neutrophils were significantly reduced at the fifth day of treatment (after the 10th application of ozone treatment) compared to baseline. Furthermore, the lymphocytes percentage increased in both groups, but only with a significant (p<0.05) difference in the control group. Both figures of neutrophils and lymphocytes (baseline and 5th day) were within the reference values.

The biochemical behavior in blood serum in terms of triglyceride values, there was a significant increase for both groups on the fifth day regarding the baseline values, being the value in the control group within the range of normal values. Cholesterol values were significantly reduced in the control group in comparison with the baseline value. In the group of patients treated with rectal ozone therapy on the fifth day, a significant reduction in ALT levels was observed in the ozone group in comparison with the baseline. During all the biochemical analyzes carried out on the blood, it was found that, despite observing some significant differences in some indicators at the fifth day of treatment in comparison with the baseline value, none of these are outside the values of references reported as normal.

With respect to adverse events, there are no significant differences among the study groups. In 12 patients presented AE for 75%, and only 4 patients did not present AE (25%). In the group of control patients, 9 of them (56.3%) who presented AE were registered, and 7 (43.8%) who did not present AE. There were no significant differences between the two groups. The intensity of the side effects was considered mild and moderate for both groups.

The adverse events associated with rectal ozone application were feeling of full intestines, tenesmus, colics and intestinal peristaltic movements. Adverse events were recorded daily.

No deaths or serious AE were reported during the study. These patients have their general condition compromised, which together with the adverse reactions generated by the conventional drugs (Heberferon, kaletra, chloroquine) that they are taking, mask the real response to the tolerability of ozone therapy.

The physical safety indicators evaluated showed a significant reduction in the bodyweight of the patients after the fifth day of treatment in both groups (Table 5). On the other hand, a significant reduction in respiratory rate was evidenced in the control group on the fifth day, but despite reaching statistical significance, is considered not relevant within the analysis of the general condition of the patient, since none of these worsened their clinical symptoms.

No deaths or serious AE were reported during the study.

Discussion

This exploratory clinical trial results showed negative RT-PCR in the 81% of patients treated with conventional treatment plus ozone rectal insufflation every 12 h after 10 applications of ozone therapy, with significant differences with regards to the control group (conventional treatment) where only 43% of the patients obtained negative RT-PCR in the same time. Regarding the percentage of negative RT-PCR on the 10th day (20 applications of ozone therapy), the significant differences in favor of ozone therapy are maintained. This result, is considered the first evidence on the effect of rectal ozone therapy on the PCR result in COVID 19 positive patients with mild and moderate symptoms. Similar results were reported in a clinical trial in COVID-19 positive patients with mild and moderate symptoms, who were treated with the combination of rectal ozone therapy and minor autohemotherapy (minor AHT). The scheme used was rectal ozone therapy twice daily (150 mL of ozone volume with a concentration of 40 mg/L) and minor AHT less than 25 mg/L of ozone concentration, once a day. The results confirm that 77% of the patients had a negative RT-PCR at day 5, compared to 43% in the control group. After the 10th day, 100% of the cases showed negative RT-PCR in the ozone therapy group, which was significantly higher compared to 70% in the control group [30].

On the other hand, it is important to point out that the negative RT-PCR in patients with rectal ozone therapy was accompanied by a significant improvement in clinical symptoms on the 5th day, compared to the control group. Regarding the evaluation of the treatment’s global response, it was identified that rectal ozone therapy favored significantly the total response (negative RT-PCR and disappearance of clinical symptoms) compared to the control group, both in the analysis to 5 days. Similar results are reported in the clinical trial [30], where the cough and dyspnea, improved on the 5th and 10th day of treatment with rectal ozone therapy and minor AHT, compared to the control group.

In a recent study, the effectiveness of rectal ozone therapy was reported on the clinical symptoms of COVID-19. This study was carried out in four patients with severe pneumonia [23]. It describes that after 10 and 39 days with failed evolution under conventional treatment (retroviral drugs, IL6 and IL1 inhibitors, antibiotics and methylprednisolone), rectal ozone therapy was applied compassionately, five applications of 100 mL volume with a 35 mg/L ozone concentration, which resulted in a significant improvement dyspnea, respiratory rate, and oxygen saturation.

Other studies report the success of ozone therapy, applied by major autohemotherapy (M-AHT), in patients with COVID 19 in critical condition, hospitalized in intensive care units (ICU), in which the efficacy of the treatment was reported in terms of the improvement of the patient’s health status, or condition in a much shorter time than in conventional treatment [21]. A percentage of 53% of SARS-CoV 2 positive patients, treated with ozone therapy via M-AHT, significantly improved clinical symptoms compared to the control group [31].

C-reactive protein (CRP) is synthesized in the liver and is an acute reactive phase protein that is increased in the blood in a wide range of inflammatory diseases. This protein is increased in 73-93% of patients infected with COVID-19, particularly in the severe phase of the disease [32]. All the COVID-19 patients included in this trial, characterized by mild and moderate symptoms, presented mean values of CRP higher than those reported as normal (<6 mg / L). Both, ozone therapy group and conventional treatment reduced CRP levels on the 5th day of evolution, with percentages of changes of 49.4% and 52.3%, respectively. This reduction was only statistically significant in the control group. Although the ozone group did not show statistical significance, the possibility that this result is influenced by the fact that the number of patients was low and there was a high standard deviation should be considered. As reported in other studies, rectal ozone therapy reduces CRP in patients with COVID-19 (mild and moderate) [32] and also in severe patients treated with ozone therapy via MAHT [24]. Other inflammatory and thromboembolic markers such as IL-6 and Dimer-D were reduced by MAHT ozone therapy in COVID-19 patients hospitalized in intensive care units. In addition, ozone improved the respiratory function indicators, such as oxygen saturation percentage (Sat O2) and the arterial pressure index of oxygen/fraction of inspired oxygen (PaO2 / FiO2) [19].

Regarding the analysis of the cellular indicators of the inflammatory response, a significant reduction in N/L ratio was observed in the group treated with ozone after 5 days of treatment, which corresponds to the increase in the lymphocyte count in this group. Although in the control group there were no statistically significant differences regarding this indicator, a tendency to decrease was observed after 5 days of treatment. The N/L ratio index is a predictive prognostic factor for the risk of death in hospitalized SARS CoV 2 positive patients undergoing endotracheal intubation with prognostic values of N/L > 4.94 reported by Tatum D. et al. (2020) [33]. In this study, the patients presented baseline N/L values of 2.5 and 2.3 in the ozone and control group, respectively, decreasing to 1.5 and 1.6 in each group after 5 days of treatment, which is consistent with the improvement of patients and favors the prognosis of the disease.

On the other hand, considering the oxidative stress indicators evaluated in the study is analyzed was verified that pro-oxidant indicators (MDA, PAOP and NO) do not suffer significant changes in the patient group treated with rectal ozone therapy. Some results support the association between oxidative stress, inflammation, and the pathogenesis of SARS-COV infection [34]. In the preclinical setting, it is evidenced that the overproduction of Reactive Oxygen Species (ROS) and a deprived system of antioxidants play a major role in the pathogenesis of SARS-CoV infection, as well as in the progression and severity of the respiratory disease. Experimental animal models of severe acute respiratory syndrome have shown increased ROS levels and impaired antioxidant defense during SARS-CoV infection [35]. Some authors suggest that the appearance of a severe lung injury in patients infected by SARS-CoV depends on the activation of oxidative stress that is coupled with innate immunity and activates transcription factors, such as NF-kB, resulting in a response proinflammatory in the host in an exacerbated form [36].

In this study, it is highlighted that rectal ozone therapy significantly increased the GSH content on the fifth day of treatment, in comparison with the basal content and with the value of the control group on the fifth day [36]. These results correspond to those achieved in other trials carried out in chronic diseases (rheumatoid arthritis) [37], heart failure [38], multiple sclerosis [39] and coronary artery disease [40], among others, where demonstrates the stimulating action of ozone therapy on endogenous antioxidant systems. On the other hand, both treatments experienced an increase in CAT activity, without differences between them. The pro-oxidant indicators analyzed (MDA, PAOP) did not show significant changes on the fifth day of treatment.

Several studies indicate that higher glutathione levels can improve an individual’s responsiveness to viral infections. It protects the host’s immune cells through its antioxidant mechanism and is also responsible for the optimal functioning of a variety of cells that are part of the immune system. Glutathione inhibits the replication of various viruses at different stages of the viral life cycle, and this antiviral property of GSH appears to prevent the increase in viral load and the subsequent massive release of inflammatory cells in the lung (“cytokine storm”). Endogenous glutathione deficiency appears to be a crucial factor that increases the oxidative damage of the lung induced by SARS-CoV-2 and, as a result, leads to severe manifestations such as acute respiratory distress syndrome, multiple organ failure and death in patients with COVID-19 [41].

The nuclear transcription factor Nrf2 is the main regulator of the antioxidant response element (ARE) that directs the expression of cytoprotective proteins. Nrf2 confers protection against these pulmonary disorders [42], stimulates the innate immune system, eliminating numerous pathogenic bacteria and viruses [43]. Recently, a study in 40 patients showed that COVID-19 severity was directly related to the age and inflammatory response intensity was inversely associated with Nrf2 expression [44]. Patients with COVID-19 showed suppression of Nrf2 pathway, however, the pharmacological inducers of Nrf2 inhibited the replication of SARS-CoV2 and decreased the levels of inflammatory response [47]. Nrf2 agonists induce interferon (IFN)-independent antiviral program that is widely effective in limiting virus replication and suppressing pro-inflammatory responses of human pathogenic viruses, including SARS-CoV-2 [45].

It is well known that ozone therapy stimulates endogenous antioxidant systems through the expression of Nrf2 [5], which was confirmed in a clinical trial of multiple sclerosis, where rectal ozone therapy modulated the inflammatory response mediated by cytokines and increased antioxidant activity, accompanied by increased expression of Nrf2 [46]. There are several studies where have been well demonstrated that ozone therapy increases the level of Nrf2, with an improvement of the antioxidant defense system [47,48].

Although the physical examination of the patients showed a significant reduction in the weight of the patients 5 days after starting the treatment, for both groups, this indicator did not constitute a parameter of non-safety of the treatments, since it considers the influence of other aspects, such as the change of diet, the hospitalization of the patient and the general clinical symptoms that he presented, which prevented him from eating properly and therefore maintaining his body weight. Furthermore, no significant changes were observed in terms of hematological and blood chemistry indicators. The rest of the variables remained within the ranges of normal values.

Both treatments were tolerable. Within the tolerability classification, the highest percentage was regular for both treatments, both with high percentages, ozone therapy 60% and control 50%. The tolerability obtained for ozone therapy in this study is contradictory, as previous studies have shown that rectal ozone therapy has been very well tolerated [49]. This result could be subject to the fact that these patients, unlike those in other clinical trials, despite presenting mild and moderate symptoms of COVID-19, have implications for the general intake of their status, which together with adverse reactions generated by conventional drugs (Heberferon, Kaletra, chloroquine), mask the real response to the tolerability of ozone therapy. On the other hand, if we consider that ozone therapy significantly reduced the clinical symptoms of the patients compared to the control, we could confirm that this classification was influenced by the general deterioration of the patients as they were under so many adverse effects caused by the conventional medications.

AE occurred in 75% of the patients in the group that received treatment with rectal ozone therapy and in 56% of the patients in the control group. This difference between the groups with respect to this indicator was not statistically significant. These results were not as expected, since, according to experience and reports in the literature on clinical trials with rectal ozone therapy, this procedure, in general, does not cause AE in this sense, only very few and of mild intensity have been reported [50-52].

But, in this trial for the first time, rectal ozone therapy is being used in patients with COVID-19 in conjunction with conventional treatment (retroviral and others) who have adverse reactions. For example, in the study performed in COVID-19 convalescent patients treated with rectal ozone therapy, 80% (28/36) of the patients reported the feeling of fullness of the intestines, without other reports, that disappeared rapidly and in no case, treatment was required [53]. In addition, a high index of well-being was observed in the group of patients who received ozone and the safety in the use of this technique confirmed its therapeutic usefulness.

The compliance with the treatments by the ozone therapy group should be highlighted, in which no patient interrupted the treatment for any reason. However, in the control group 6 patients (37.5%) did not comply with the administration of Kaletra and chloroquine and 3 (18.8%) received incomplete treatment, which could be the reason why the analysis of the presentation of AE, had an increasing trend in the group that received rectal ozone therapy, although this was not statistically significant in comparison with the control group.

In conclusion, the results of this exploratory clinical trial show that rectal ozone therapy applied at the doses and therapeutic scheme described was effective and safe as an adjunctive treatment in positive patients for COVID-19. Ozone therapy significantly achieved a negative RT-PCR in 81 % of patients and reduced clinical signs after five days of treatment. This primary efficacy result was accompanied by an increase in the glutathione content and the activity of CAT in the serum of the patients, improving the endogenous antioxidant response. This exploratory study demonstrates the efficacy and safety of rectal ozone therapy in both mild and moderate symptomatic SARS-CoV 2 positive patients. The combined treatment showed superior efficacy to conventional treatment by reducing the time in which patients improve clinical symptoms and obtain a negative RT-PCR. In both groups, oxidative stress indicators and cellular markers of inflammation improve, and the treatments are safe and well-tolerated. As it is an exploratory study, the number of patients included limits the scope of these conclusions, so future Phase III studies should confirm the results found.

Acknowledgments

The authors give specials thanks to the Cuban Ministry of Public Health, especially to the head of Natural and Traditional Medicine Department, Dr. Johan Pedomo. Specials thanks to all hospital staff involved in the study, the administrative staff and patients who voluntarily agreed to be part of the research. This research was supported by National Center for Scientific Research, BioCubaFarma, Cuba, Cuban Ministry of Public Health.

References

  1. Zhu N, Zhang D, Wang W, X Li, B Yang, et al. (2020) China Novel Coronavirus Investigating and Research Team. N Engl J Med 382: 727-733. [crossref]
  2. Fara A, Mitrev Z, Rosalia RA, Assas BM (2020) Cytokine storm and COVID-19: a chronicle of pro inflammatory cytokines. Open Biol 10: 200160. [crossref]
  3. Paracha UZ, Fatima K, Alqahtani M, Chaudhary A, Abuzenadah A, et al. (2013) Oxidative stress and hepatitis C virus. Virol J 10: 251.
  4. Menendez CS, Marques MJA, Hernández MA, Hidalgo TFJ, Baeza NJ (2020) Therapeutic Effects of Ozone Therapy that Justifies Its Use for the Treatment of COVID-19. Journal of Neurology and Neurocritical Care 3: 1-6.
  5. Re L, Martínez-Sanchez G, Bordicchia M, Malcangi G, Pocognoli A, et al. (2014) Is ozone pre-conditioning effect linked to Nrf2/EpRE activation pathway in vivo? A preliminary result. J. Pharmacol 742: 158-162. [crossref]
  6. Pecorelli A, Bocci V, Acquaviva A, Belmonte G, Gardi C, et al. (2013) NRF2 activation is involved in ozonated human serum upregulation of HO-1 in endothelial cells. Toxicol Appl Pharacol 267: 30-40. [crossref]
  7. Hassan SM, Jawad MJ, Ahjel SW, Singh RB, Singh J, et al. (2020) The NrF2 activator (DMF) and Covid- 19: Is there a possible role? Med Arch 74: 134-138. [crossref]
  8. Bocci V, Zanordi I, Valachi G, Carraro F, Valachi G (2015) Validity of Oxygen-Ozone Therapy as integrated medication from in chronic inflammatory diseases. Cardiovasc Hematol Disord Drug Targets 55: 127-138. [crossref]
  9. Bocci V, Aldinucci C, Mosci F, Borrelli E, Valler Travaglil (2007) Ozonation of human blood induces a remarkable upregulation of heme oxygenase-1 and heat stress proteins- 70. Mediators Inflamm 26785. [crossref]
  10. Bette M, Nusing RM, Mutters R, Zamora ZB, Menendez S, et al. (2006) Efficiency of tazobactam/piperacilin in lethal peritonitis is enhanced after preconditioning of rats with O3/O2 pneumoperitoneum. Shock 25: 23-29. [crossref]
  11. Zamora RZ, Guanche A, Alvarez RG, Rosales FH, Alonso Y, et al. (2009) Preconditioning with ozone/oxygen mixture induces reversion of some indicators of oxidative stress and prevents organic damage in rats with fecal peritonitis. Inflamm Res 58: 371-375. [crossref]
  12. Guanche D, Zamora Z, Hernández F, Mena K, Alonso Y, et al. (2010) Effect of ozone/oxygen mixture on systemic oxidative stress and organic damage. Toxicol Mech Methods 20: 25-30. [crossref]
  13. Zamora RZ, Guanche D, Alvarez RG, Martinez Y, Alonso Y, et al. (20110 Effects of ozone oxidative preconditioning on different hepatic biomarkers of oxidative stress in endotoxic shock in mice. Toxicol Mech Methods 21: 236-240. [crossref]
  14. Calunga JL, Menendez S, Zamora Z (2019) Ozonetheray on rats submitted to subtotal nephrectomy: role of interleukin 6 and antioxiden System. Revista Cubana de Investigaciones Biomedicas 38.
  15. León OS, Takon GO, López GC, Serrano EI, García FE (2020) Gamma Glutamil transferasa, un marcador de la eficacia clínica del ozono médico y su rol patológico en artritis reumatoide y la osteoartritis de rodilla. Rev Cuba Reumatol 22: e104.
  16. Wilkins I, Delgado RL, Barrios J M, Popoco GBF (2015) Rectal insufflation of ozone attenuates chronic oxidative stress in elderly patients with cardiovascular diseases. Oxid Antioxid Med Sci 4: 23-27.
  17. Viebahn HR, León FOS, Fahmy Z (2012) Ozone in Medicine: The Low-Dose Ozone Concept-Guidelines and Treatment Strategies. Ozone Science & Engeneering 34: 408-424.
  18. Zheng Z, Dong M, Hu K (2020) A preliminary evaluation on the efficacy of ozone therapy in the treatment of COVID-19. Journal of Medical Virology 92: 2348-2350. [crossref]
  19. Franzini M, Valdenass L, Ricevuti G, Chirumbolo S, Depfenhart M, et al. (2020) Oxygen-ozone (O2-O3) immunoceutical therapy for patients with COVID-19. Preliminary evidence reported. International Immunopharmacology 88: 106879. [crossref]
  20. Ricevuti G, Franzini M, Valdenassi L (2020) Oxygen-ozone immunoceutical therapy in COVID-19 outbreak: facts and figures. Ozone Therapy 5.
  21. Hernández A, Viñals M, Isidoro T, Vilas F (2020) Potential role of Oxygen-Ozone therapy in treatment of COVID.19 Pneumonia. Am J Case Rep 17-21: e925849. [crossref]
  22. Peña-Lora D, Albaladejo-Florin MJ, Fernández-Cuadros ME (2020) Uso de Ozonoterapia en paciente anciana con neumon´ıa grave por COVID-19. Rev Esp Geriatr Gerontol. 55: 362-364.
  23. Fernández CE, Albaladejo FMJ, Álava RS, Usandizaga EI, Martinez QDJ, et al. (2020) Effect of Rectal Ozone (O3) in Severe COVID-19 Pneumonia: Preliminary Results. SN Compr Clin Med 2: 1328-1336. [Crossref]
  24. Motchnik P, Frei B, Ames B (1994) Measurement of antioxidants in human blood plasma. Methods in Enzymology 234: 269-279.
  25. Erdelmeier I, Gerard D, Yadan J, Chaudiere J (1998) Reactions of N methyl-2-phenyl-indole with malondialdehyde and 4-hydroxialkenals. Mechanistic aspects of the colorimetric assay of lipid peroxidation. Chem Res Toxicol 11: 1176-1183. [crossref]
  26. Marklund S, Marklund G (1974) Involvement of the superoxide anion radical in the autooxidation of pyrogallol and a convenient assay form superoxide dismutase. Eur J Biochem 47: 469-74.
  27. Clairborne A (1986) Catalase activity. In: Green-Wald R, editor. Handbook of Methods for Oxygen Radical Research. Boca Ratón: CRC Press, 283-284.
  28. Witko-Sarsat V, Friedlander M, Capeillere-Blandin C, Nguyen A, Zingraff J, et al. (1998) Advanced oxidation protein product as novel mediators of inflammation and monocytes activation in chronic renal failure. J Immunol 161: 2524-2532. [crossref]
  29. Granger DL, Taintor RR, Boockvar KS, Hibbs JBJr (1996) Determination of nitrate and nitrite in biological samples using bacterial nitrate reductase coupled with the Griess reaction. Methods Companion. Meth Enzymol 268: 142-151.
  30. Shah M, Captain J, Vaidya V, Kulkarni A, Valsanghkar K, et al. (2021) Safety and efficacy of ozone therapy in mild to moderate COVID 19 patients: A phase I/II randomized control trial (SEOT study). Int Immunopharmacol 91: 107301. [crossref]
  31. Tascini C, Sermann G, Pagotto A, Sozio E, De Carlo C, Giacinta A, et al. 2021 Blood ozonization in patients with mild to moderate COVID-19 pneumonia: a single centre experience. Intern Emerg Med. 16: 669-675. [crossref]
  32. Lippi G, Plebani M (2020) The critical role of laboratory medicine during coronavirus disease 2019 (COVID-19) and other viral outbreaks. Clin Chem Lab Med 19. [crossref]
  33. Tatum D, Taghavi S, Houghton A, Stover J, Toraih E, et al. (2020) Neutrophil-to-Lymphocyte Ratio and Outcomes in Louisiana COVID-19 Patients Multicenter Study. Shock 54: 652-658. [crossref]
  34. Shao H, Lan D, Duan Z, Liu Z, Min J, et al. (2006) Upregulation of mitochondrial gene expression in PBMC from convalescent SARS patients. J Clin Immunol 26: 546-54. [crossref]
  35. van den Brand JMA, Haagmans BL, van Riel D, Osterhaus ADME, Kuiken T, et al. (2014) The pathology and pathogenesis of experimental severe acute respiratory síndrome and influenza in animal models. J Comp Pathol 151: 83-112. [crossref]
  36. Smith JT, Willey NJ, Hancock JT (2012) Low dose ionizing radiation produces too few reactive oxygen species to directly affect antioxidant concentrations in cells. Biol Lett 8: 594-597.
  37. Fernández OSL, Viebahn-Haensler R, Cabreja GL, Espinosa IS, Matos YH, et al. (2016) Medical ozone increases methotrexate clinical response and improves cellular redox balance in patients with rheumatoid arthritis. J. Pharmacol 789: 313-318. [crossref]
  38. Buyuklu M, Kandemir FM, Set T, Bakırcı EM, Degirmenci H, et al. (2017) Beneficial effects of ozone therapy on oxidative stress, cardiac functions and clinical findings in patients with heart failure reduced ejection fraction. Toxicol 17: 426-433. [crossref]
  39. Delgado L, Romo MR, Mesta F, Matos YH, Barrios J, et al. (2017) Medical Ozone Promotes Nrf2 Phosphorylation Reducing Oxidative Stress and Pro-Inflammatory Cytokines in Multiple Sclerosis Patients. European Journal of Pharmacology. 811:148-154. [crossref]
  40. Martínez SG, Delgado RL, Díaz BA, Pérez DG, Re L (2012) Effects of ozone therapy on haemostatic and oxidative stress index in coronary artery disease. J. Pharmacol 691: 156-162. [crossref]
  41. Polonikov A (2020) Endogenous Deficiency of Glutathione as the Most Likely Cause of Serious Manifestations and Death in COVID-19 Patients. ACS Infect Dis. 6:1558-1562. [crossref]
  42. Liu Q, Gao Y, Ci X (2019) Role of Nrf2 and its activators in respiratory diseases. Oxid Med Cell Longev 7090534. [crossref]
  43. Battino M, Giampieri F, Pistollato F, Sureda A, de Oliveira MR, Pittalà V, et al. (2018) Nrf2 as a regulator of innate immunity: A molecular Swiss army knife!. Biotechnol. Adv 36: 358-370. [crossref]
  44. McCord JM, Hybertson BM, Cota-Gomez A, Gao B (2020) Nrf2 Activator PB125®asPotential TherapeuticAgent Against COVID-19. BioRxiv 12: 518.
  45. Olagnier D, Farahani E, Thyrsted J, Cadanet J, Herengt A, et al. (2020) Identification of SARS-CoV2-mediated suppression of NRF2 signaling reveals a potentantiviral and anti-inflammatory activity of 4-octyl-itaconate and dimethyl fumarate. Nature Communications 11: 4938. [crossref]
  46. Delgado RL, Mesta F (2020) Oxidative Stress as Key Player in Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) Infection. Arch Med Res 51: 384-387. [crossref]
  47. Pecorelli A, Bocci V, Acquaviva A, Belmonte G, Gardi C, et al. (2013) Nrf2 activation is involved in ozonated human serum upregulation of HO-1 in endothelial cells. Toxicol Appl Pharmacol 267: 30-40. [crossref]
  48. Meng W, Xu Y, Li D, Zhu E, Deng L, et al. (2017) Ozone protects rat heart against ischemia-reperfusion injury: A role for oxidative preconditioning in attenuating mitochondrial injury. Biomed Pharmacother 88: 1090-1097. [crossref]
  49. Viebahn RR, Leon OS, Fahmy Z (2016) Ozone in medicine: Clinical evaluation and evidence classification of the systemic ozone application, major Autohemotherapy and rectal insufflation, according to the requirements for evidence-based medicine. Ozone science & Engineering 38: 322-345.
  50. Razzaq HA, Al-Hmadi HB, Al-Silaykhee WM (2020) Use of ozone as an adjuvant therapy for patients with COVID-19 in Iraq. A Comparison study with studies from other countries. J Crit Rev 7: 2033-2038.
  51. Marini S, Maggiorotti M, Dardes N, Bonetti M, Martinelli M, et al. (2020) Oxygen-ozone therapy as adjuvant in the current emergency in SARS-COV-2 infection: A clinical study. J Biol Regul Homeost Agents 34: 757-766. [crossref]
  52. Zheng Z, Dong M, Hu K (2020) A preliminary evaluation on the efficacy of ozone therapy in the treatment of COVID19. J Med Virol 92: 2348-2350. [crossref]
  53. Gil del Valle L, López FOE, Sánchez MJA, Zamora RZ, Carballo RAL, et al. (2020) Amelioration of symptoms and oxidative stress in hospitalized convalescent post SARS-COV-2 patients treated with rectal ozonetherapy and nutritional supplementation. IJMPR 4: 94-107.

Rainbow Paratha – Establishment of Common People Diet in Post Pandemic Situation as Protective Measure and Immunity Enhancer

DOI: 10.31038/NRFSJ.2023613

Abstract

A remarkable increase is recorded regarding global burden of non-communicable lifestyle diseases. Prevalence of non-infectious diseases especially type 2 Diabetes, hypertension, depression, anxiety, arthritis etc. are directly related with the lifestyle patterns including the “Diet” that has been consumed during the course of lifetime. Food and health are correlated; improper food intake will produce detrimental effects on health leading to altered body physiology ultimately resulted in persistent illness. By incorporating functional foods in daily routine will strengthen the overall health and immune system, detoxify the organs, leading to delay age related degeneration of organs and symptoms. Purpose of this study was to design a unique functional food termed as “Rainbow Paratha” using whole wheat flour (Triticum aestivum) as main medium mixed with antioxidants herbs mainly Beeta vulgaris leaves and root and Moringa oleifera leaves. To add on taste and nutritional value some wet condiments (ginger, garlic, turmeric, and onion) and some dry condiments (black pepper, cumin, and fenugreek) were also added. Taste was developed using pink salt and mustard oil, while garnishing was done with coriander and peppermint leaves to make paratha presentable. Dough was made using mustard oil and distilled water. This paratha is safe to use as a functional food, boost immunity and improve health. Natural antioxidants in this paratha will detoxify the body with reactive oxygen species preventing from chronic diseases. It can be concluded that this product will not only satisfy the hunger and provide prompt responding nutrients to consumers but may prevent some lifestyle diseases and try to maintain perfect health without any untoward effects.

Keywords

Beeta vulgaris roots and leaves, Moringa oleifera, Functional food, Immunity, Chronic diseases

Introduction

Food provides the basic fuel necessary for the survival and maintenance of human life. On scientific ground relationship between diet and health has been established and studied by researchers all over the world. Unbalanced diet or processing of food in unscientific manner will result in compromised nutritional value; finally leading to the prevalence of different diseases. Japan introduced the term functional food for the first time in mid 80s, by then it has been adopted the shape of modern industry all over the world. The Concept of functional food is nothing but based on two main parameters of human life i.e. diet and health. Any food that may be utilized on daily basis for preventing diseases via improving overall health is considered as functional food. Functional foods may be conventional natural food, having fortified food components, and synthesized food ingredients. There are a lot of data available that support the practice of incorporating functional food on daily routine will result in improved health and delay of chronic diseases like hypertension, diabetes etc. [1-4].

Majority of chronic diseases are associated with high oxidative stress on the body. Increased level of Reactive Oxygen Species (ROS) or free radicals in the body will gradually result in prevalence of lifestyle diseases like hypertension, diabetes, neurodegenerative diseases like Alzheimer’s, and even malignant conditions of various organs [5-9].

Nature has blessed humankind with a range of edible and medicinal plants having antioxidant potential and these are available according to seasonal variations. Incorporation of edible plants having natural antioxidants in our daily diet plan can improve our health through maintaining body’s own metabolic processes ; strengthen immune system, boosting body’s own free radical scavenging activity. Hence the overall health condition will be improved and the natural process of aging and age related complications could be minimized.

Purpose of this research is to introduce a natural functional food after pandemic situation of COVID-19 that has antioxidant and immune boosting potential, known as “Rainbow Paratha”. We made this paratha using whole wheat flour, mixing with edible Beeta vulgaris roots and leaves and Moringa oleifera that are rich in antioxidant poly phenols and can be safely consumed as are non-toxic [10,11,16,17]. Other condiments having beneficial and safe phytochemicals are also added to add on flavor according to the taste buds of Asians population. Grated rhizome of ginger and garlic along with onion were used as wet condiments of the preparation. Dry condiments are also the primary part of the preparation like turmeric, cumin, black pepper, and fenugreek along with maintaining the taste with pink salt, with coriander and peppermint leaves not only as garnishing agent but also for significant taste and aroma. Mustard oil was used to process the dough into cooked paratha that itself have very advantageous effects. All of these wet and dry condiments are routinely utilized in Pakistani cuisines and not only enhance the taste but also beneficial for health as containing valuable phytochemical nutrients that can be used in moderate amounts.

Materials and Methods

Preparation of rainbow paratha is composed of some simple steps including collection of ingredients, dough preparation, processing the dough, and cooking.

Collection of Material/Ingredients

Ingredients used in the preparation of rainbow paratha were procured from local market of Karachi, Pakistan and identified by Prof. Dr. Ghazala H Rizwani. It includes some fresh materials as well as some regional spices (wet and dry condiments) according to the taste of local Pakistani population. All the materials required for making rainbow paratha are listed in Table 1.

Table 1: Description of Composition of Rainbow paratha

TAB 1(1)

TAB 1(2)

TAB 1(3)

TAB 1(4)

TAB 1(5)

TAB 1(6)

Experimental Design

Dough Preparation and Processing

Table 2 represents the percentage amount of all ingredients used to make the dough; while all steps involved in the preparation of this product is summarized in Figure 1. Firstly all dry ingredients were mixed well in flour followed by gradual addition of cooking oil. Simple drinking water was used for Dough preparation. Dough was kneaded with the help of hands to obtain uniform consistency. It was covered with moist muslin cloth at room temperature for half an hour before further processing. The respective dough was divided into small pieces of approximately equal size. Each piece of dough was rolled out in the shape of round Paratha using roller pin.

Table 2: Percentage composition of Ingredients used in rainbow paratha

TAB 2

 

FIG 1

Figure 1: Steps involved in making Rainbow Paratha

Cooking of Paratha dough

The resulted prepared dough in addition with 2-3 table spoons of mustard oil warmed at 180 C for at least 5 minutes on a nonstick pan. Warming of mustard oil till smoke point is necessary to remove its toxic constituents allyl isothiocyanate responsible for its bitter taste and to convert bitter oil into edible sweet mustard oil.

Results and Discussion

COVID-19 pandemic has influenced the life of mankind in various aspects including from physical and mental health, economy, socialization and the overall immune system. Post pandemic scenario has opened new global challenges for medical professionals, pharmacists, dieticians, and researchers to address and solve health complications and strengthen the immune system so that our bodies will be able to defend itself in case of reoccurrence of the disease or other variant of corona virus. A strong immune system will safeguard the person with all kinds of illness and complications.

In 21st century attention is paid towards maintain the diet in such a way that food itself becomes medicine for individuals. Concepts of functional foods, neutraceutical reflecting the healthy eating habits are on the rise to boost up immunity. The concept of our research of designing rainbow paratha is based on this fact that by incorporating healthy food items having antioxidant potential in our cuisine will help naturally us to fight against diseases.

Rainbow paratha is prepared using wheat flour as main medium, with antioxidants herbs, and some dry and wet condiments and flavoring agents. The details of all components of rainbow paratha are given as;

Main Medium

Triticum aestivum (Whole Wheat Flour)

Whole wheat flour was taken as main medium to prepare the dough. It was selected because wheat flour is the most widely used type of grain in Pakistan. Although due to high amount of carbohydrate it is considered as a source of energy but it also perform some valuable functions like anti-diabetic, anti-microbial, and even anti-malignant effects also [25].

Main Herbs

Beta vulgaris (Beet Root and leaves)

Beet root is highly nutritive food full of vitamins, mineral, and nitrates. Fresh beet roots with its green leaves are used in this product that has miraculous effects on health. Most of the chronic diseases are slowly developing in the body, moreover gradual accumulation of toxins and metabolic wastes will weaken the immune system and damages organs. Use of beet root with its leaves detoxifies liver getting rid from disease progression. It is also beneficial to main high blood pressure so delays the onset of hypertension in border line patients. It is also helpful in making heart health in good condition; also decreases cholesterol levels. Due to hemopoitic action it is good for treating anemia [16,17].

Moringa oleifera (Moringa leaves)

Moringa oleifera is known as “Magical vegetable” because of its miraculous uses both as functional food and medicine. Its use has not only been proved scientifically effective but also safe for human consumption. In our Rainbow paratha recipe we used fresh leaves of moringa that are rich in natural antioxidants like vitamin C, poly phenols, and carotenoid. Moringa plant has long history of therapeutic utilization in traditional system of medicines for its anti-inflammatory, anti-microbial, diuretic, anti-hyperlipidemic, anti-hypertensive, anti-diabetic activities. Presence of these antioxidants will decrease the oxidative stress hence preventing from different chronic diseases [10-13].

Dry Condiments

Piper nigrum (Black pepper)

Black pepper having a characteristic spicy and pungent odor and taste is very popular food condiment in Asian cuisines. This plant has deep cited history of use as medicine as well as food spice. Piperine, piperidine are the main constituents responsible for medicinal actions. It is widely used for respiratory complaints [18,19].

Trigonella fonumgraceum (Fenugreek)

Fenugreek is another condiment used in making rainbow paratha. It is also one of the popular food condiments in Asia having nice aroma and bitter taste. Methi dana is rich in fat soluble vitamins A and D, Steroidal sapogenin, disogenin, hecogenin, mucilage, Wax, volatile oil and used as tonic, flatulence, antidiarrheal, emonenagouge and laxative [20]. Since it has a bitter taste so whole seeds are used instead of crushing it to maintain the taste.

Cuminum cyminum (White Cumin)

Whit cumin has characteristic aromatic odor and spicy taste. It contains Essential oil especially pinene, cuminic aldhehyde (25-35%) and used as diuretic, carminative, condiment, stomachic, astringent, anti-diarrheal, dyspepsia, antiseptic, flavoring agent [22].

Wet Condiments

Curcuma longa (Turmeric)

Curcuminoids (Curcumin, Demethoxycurcumin, Bisdemethoxycurcumin) are Nontoxic Polyphenolic derivatives of Curcumin that make it very beneficial. It is used as analgesic, diuretic, antioxidant, bactericidal, hypotensive, rubefacient, stimulant, reduce risk of serious health conditions like heart disease, diabetes, sores, bruises, osteoarthritis [21].

Allium sativum (Garlic)

Garlic is well known for its cardio protective action, it protects the heart, lowers blood pressure, shows fibrinolytic activities [30].

Allium cepa (Onion)

Onion is a widely used ingredient of Pakistani cuisine. Due to its detoxification action, it prevent tissue, organ and system damage from Heavy metal and other type of poisoning. Uric acid level is also controlled by incorporating onion in daily routine [31].

Brassica compestris (Mustard oil)

Mustard oil has a strong and pungent flavor with high smoke point. Isothiocyanate, Glucosynolate also known as mustard oil glycosides is responsible for the characteristic taste and aroma of mustard oil. Mustard oil is very beneficial for health due to its unique fatty acid composition. It reduces cholesterol level, well for heart, anti-inflammatory, treat pain associated with arthritis; stimulate sweat gland and lower body temperature [14,15]. Heating the oil will mask its pungent taste so in our recipe mustard oil was heated till its smoke point prior to use it.

Garnishing and Flavoring Agents

Coriandrum sativum (Coriander)

Fresh coriander leaves were used. It contains Camphor, geraniol, Coriandrol, Linalool, pinene, limonene, carvone and used for rheumatisem, dysentery, piles, flatulence, hernia Measles, nausea, and toothache [23].

Mentha pipperata (Peppermint)

Peppermint leaves contain essential oil like methol, menthone, limonine showing antioxidant, anti-microbial, anti-viral activities [24].

The paratha is a processed product of dough. All steps of dough making are physical i.e. mixing of ingredients, kneading the material with water to make dough, resting period. All these physical steps does not affect the nutritional value of paratha as a functional food; the only step that can change the nature of thermolabile phytochemicals especially polyphenol is the conversion of thin rolled sheets of dough into the processed form paratha i.e. “cooking the dough at 18°C for at least 5 minutes”.

As Rainbow paratha recipe contains multiple ingredients, but all ingredients are edible and safe to utilize in daily routine. Processing of paratha is also very easy and simple; moreover its taste is also very good. It is very tasty functional food that can easily be made at home having very low cost budget.

Conclusion

After COVID-19 pandemic health conditions of people all over the globe is facing challenges. In most of the individuals immune system has been weakened in post pandemic conditions altering both Physical and mental status of populace. It is recommended to make awareness among people to maintain their health in better condition by incorporating functional foods like rainbow paratha by just adding some condiments in the traditional simple paratha which is a must part of Pakistani traditional cuisine almost at every home. It can help in strengthen the immune system and overall improved health condition of community.

References

  1. Clare M Hasler (2002) Functional Foods: Benefits, Concerns and Challenges—A Position Paper from the American Council on Science and Health The Journal of Nutrition 132: 3772-3781. [crossref]
  2. Henry C (2010) Functional foods. Eur J Clin Nutr 64: 657-659.
  3. Monica Butnariu, Ioan Sarac (2019) Functional Food. International Journal of Nutrition 3: 7-16.
  4. Temple NJ (2022) A rational definition for functional foods: A perspective. Nutr 9. [crossref]
  5. Schieber M, Chandel NS (2014) ROS Function in Redox Signaling and Oxidative Stress Review Current Biology 24: R453-R462. [crossref]
  6. Pizzino G, Irrera N, Cucinotta M, Pallio G, Mannino F, et al. (2017) Oxidative stress: Harms and benefits for human health, Oxidative medicines and cellular longevity 2017: 13. [crossref]
  7. Rajendran P, N Nandakumar, T Rengarajan, R Palaniswami, EN Gnanadhas, et al. (2014) “Antioxidants and human diseases,” Clinica Chimica Acta 436: 332-347. [crossref]
  8. Kumar S, AK Pandey (2015) “Free radicals: health implications and their mitigation by herbals,” British Journal of Medicine and Medical Research 7: 438-457. [crossref]
  9. Valko M, D Leibfritz, J Moncola, MD Cronin, M Mazur, et al. (2007) “Free radicals and antioxidants in normal physiological functions and human disease,” The International Journal of Biochemistry & Cell Biology 39: 44-84. [crossref]
  10. Vergara-Jimenez M, Almatrafi MM, Fernandez ML (2017) Bioactive Components in Moringa Oleifera Leaves Protect against Chronic Disease. Antioxidants (Basel) 6: 91. [crossref]
  11. Stohs SJ, Hartman MJ (2015) Review of the Safety and Efficacy of Moringa oleifera Res 29: 796-804. [crossref]
  12. Vongsak B, Sithisarna P, Mangmool SB, Thongpraditchote S (2013) Maximizing total phenolics, total flavonoids contents and antioxidant activity of Moringa oleifera leaf extract by the appropriate extraction method Industrial Crops and Products 44: 566-571.
  13. Sreelatha S, Padma PR (2009) Antioxidant Activity and Total Phenolic Content of Moringa oleifera Leaves in Two Stages of Maturity. Plant Foods Hum Nutr 64: 303. [crossref]
  14. BKKK Jinadasa, F Van Bockstaele, JH Cvejic, Jesus Simal-Gandara (2022) Chapter 11 – Current trends and next generation of future edible oils, Editor(s): Rajeev Bhat, Future Foods, Academic Press 2022: 203-231.
  15. Chakraborty S, Gupta SS, Sengupta A, Ghosh M (2018) Quality ascertain of different mustard oil samples Obtained from the Local market of West Bengal, India. Asian Journal of Dairy and Food Research 37: 138-143.
  16. Neha P, Jain SK, Jain NK, Mittal HK (2018) Chemical and functional properties of Beetroot (Beta vulgaris L.) for product development: A review International Journal of Chemical Studies 6: 3190-3194.
  17. El Gamal AA, AlSaid MS, Raish M, et al. (2014) Beetroot (Beta vulgaris L) extract ameliorates gentamicin-induced nephrotoxicity associated oxidative stress, inflammation, and apoptosis in rodent model. Mediators Inflamm 2014: 983952. [crossref]
  18. Saleem A, Naureen I, Naeem M, Tasleem G, et al. (2022) Therapeutic Role of Piper Nigrum L (Black Pepper) and Pharmacological Activities. Sch Int J Biochem 5: 15-21.
  19. Meghwal M, Goswami TK (2013) Piper nigrum and piperine: an update. Phytother Res 27: 1121-1130. [crossref]
  20. Yadav UC, Baquer NZ (2014) Pharmacological effects of Trigonella foenum-graecum L. in health and disease. Pharm Biol 52: 243-254. [crossref]
  21. Kocaadam B, Şanlier N (2017) Curcumin, an active component of turmeric (Curcuma longa), and its effects on health. Crit Rev Food Sci Nutr 57: 2889-2895. [crossref]
  22. Singh RP, Gangadharappa HV, Mruthunjaya K (2017) Cuminum cyminum – A Popular Spice: An Updated Review, Pharmacognosy Journal 9: 292-301.
  23. Laribi B, Kouki K, M’Hamdi M, Bettaieb T (2015) Coriander (Coriandrum sativum L.) and its bioactive constituents. Fitoterapia 103: 9-26. [crossref]
  24. Schmidt E, Bail S, Buchbauer G, Stoilova I, Atanasova T, et al. (2009) Chemical composition, olfactory evaluation and antioxidant effects of essential oil from Mentha x piperita. Nat Prod Commun 4: 1107-1112. [crossref]
  25. Minocha N, Saini S, Pandey P (2022) Nutritional prospects of wheatgrass (Triticum aestivum) and its effects in treatment and chemoprevention. Explor Med 3: 432-442. [crossref]
  26. Centers of Disease Control and Prevention (CDC). Water and Healthier Drinks; Healthy Weight, Nutrition, and Physica Activity.
  27. World Health Organization (WHO). Post COVID-19 condition.
  28. World Health Organization (WHO). The impact of COVID-19 on mental health cannot be made light of.
  29. Mao QQ, Xu XY, Cao SY, et al. (2019) Bioactive Compounds and Bioactivities of Ginger (Zingiber officinale Roscoe). Foods 8: 185. [crossref]
  30. El-Saber Batiha G, Magdy Beshbishy A, G Wasef L, Elewa YHA, et al. (2020) Chemical Constituents and Pharmacological Activities of Garlic (Allium sativum L.): A Review. Nutrients 12: 872. [crossref]
  31. Dorrigiv M, Zareiyan A, Hosseinzadeh H (2021) Onion (Allium cepa) and its Main Constituents as Antidotes or Protective Agents against Natural or Chemical Toxicities: A Comprehensive Review. Iran J Pharm Res 20: 3-26. [crossref]

Empowering Young People to become Researchers: What Does It Take to become a Police Officer?

DOI: 10.31038/PSYJ.2023531

Abstract

The study reported here on ‘what does it take to become a police officer’ represents one of several explorations of the ‘world of the adult’ from the point of view of a middle school student. The objective of these studies is to explore the nature of how students see the world of adults, doing so by providing the student with a templated research tool (www.BimiLeap.com). With this tool, and with the embedded coaching provided by the access to artificial intelligence (Idea Coach), the student can explore a topic, select aspects of the topic, and perform a real-world experiment, in the same way as a professional researcher does. The outcome shows how the student thinks about a topic, and the response to the student’s thinking by actual respondents, an outcome which at once provides knowledge about the topic and knowledge about the mind of the researcher.

Introduction

A great deal of the research involving the way young people think comes from the world of developmental psychology, with its emphasis on the nature of how the young person approaches a problem, conceptualizes the problem, and then proceeds to solve the problem. The literature of developmental psychology is vast, much of it in the hands of professional psychologists who study the topic in the rarified atmosphere of observational science [1,2]. The science, the knowledge emerging, may be idiographic, viz., detailed knowledge of an individual, or nomothetic, viz., detailed knowledge of general patterns of groups. Of interest here is how children think about future careers, specifically a career in the police force [3-6].While scientists and clinicians build up their world of understanding, there are practical issues and applications as well, best expressed by issues encountered in school and in everyday life. How does a student learn? What are the types of questions that a student asks about a topic? One example is how do students formulate questions about a topic to learn about the topic. What can we learn from those questions? And can we create a system which allows us to explore the mind of the student towards the world of the everyday?

A continuing topic in science concerns what is appropriate for science to investigate, who should do the investigation, how should the investigation be done, what should be the appropriate report, and finally what is the ultimate value of the research? For the efforts involving student researchers, often young ones who have not even graduated high school or middle school, the question revolves around the nature of the contribution that they can make. The world of academic science is replete with degreed professionals, publishing papers on topics to, in colloquial terms, ‘answer a call from the literature’ or plug a hole in the gaps of our knowledge.’ There is a sense that science is evolving to a closed world, permission to join that world granted only by degree, and only by the receipt of money to do one’s scientific research. There is no room for others. Sadly, then, this attitude, if correct, may end up limiting our knowledge about the psychology of people, especially young people, as these people focus on real-world issues. The young people may end up as subjects for the study, the study involving an external researcher trying to figure out the ideas of the young person. Why not let the young person do the research, choosing the topic, and executing the study in a way which ensures the maximum opportunity of success.

The Worldview of Mind Genomics

Mind Genomics is an emerging science, focusing on the analysis of how we make decisions about the world of the everyday [7,8]. Of relevance to the understanding of the mind of young people are at least two studies dealing done with Mind Genomics, one on hospitals [9], the other on the marketing of museums to young people [10]. Mind Genomics has emerged slowly during the past forty years, with roots and history traceable to at least three worlds of inquiry:

The first of the worlds is experimental psychology, and specifically the world of psychophysics, the study of the relation between test stimuli and the perception of these test stimuli. Psychophysics is often thought to be the earliest field of experimental psychology, with a focus on measuring the perceived intensity of test stimuli, such as the sweetness of a cola sweetened beverage. The traditional objective of psychophysics is to measure the subjective intensity of external stimuli, such as the loudness of sounds, and so forth. Mind Genomics moves the measurement inwards, to measure the magnitude of private sensory or cognitive experience. The goal, however, remains measurement.

The second world is statistics, and more specifically the role of experimental design. Mind Genomics ‘works’ by presenting vignettes (combinations of elements, viz., messages) to the respondent with the instruction to read the vignette, and rate the entire vignette as a single entity. The rationale is that in the world of the everyday the person is confronted with mixtures of elements, from which the respondent must make a decision. The person is almost never presented with a series of single elements, one at a time, and instructed to make a decision. That ‘one at a time’ strategy simply does not represent the world in which people naturally make decisions. The issue is to create the appropriate set of combinations or vignettes, allowing the researcher to uncover how each element drives the response. In other words, the respondent evaluates systematically constructed mixtures, allowing the researcher to estimate the contribution of each component of the mixture. It is statistics, specifically experimental design, which prescribes the specific combinations to create and to test [11].

The third world is consumer research, more specifically the evaluation of real-world concepts, viz., meaningful combinations of elements. Consumer research deals with topics that are meaningful and real in the everyday world, in contrast to experimental psychology and psychophysics which deal with artificially contrived situations having little or no cognitive value. A consumer researcher works with test stimuli which have meaning in the outside world. Just the word ‘consumer’ in the name ‘consumer research’ is a clue that the topics must have relevance to the real world of people, not to artificially contrived situations set up to support or disprove a hypothesis.

Templating the Mind Genomics Studies to Democratize the ‘Project of Science’

During the forty-year history of Mind Genomics, as it evolved from business-oriented studies of what to say about products into a more general understanding of how people think about topics, it became increasingly obvious that the process of creating vignettes to test was a barrier. In today’s language, the need to think about topics, to create test stimuli, and to execute and analyze experiments became ‘friction points.’ Even students, accustomed to research projects, reported that they had difficulty developing combinations of ideas to test, although few students ever reported difficulties with the ensuing statistical analysis of the data once the study was designed and executed.

During that forty year period it was becoming increasingly obvious that the process of Mind Genomics had to be streamlined, both to help the researcher develop the test stimuli / run the experiment, but also, and more profoundly, help the researcher to think in a new way. It was at this point that the effort moved towards templates, and to automating the process, an effort evolving to the use of artificial intelligence as a coach to help create the questions and the answers [12].

This paper presents the templated approach, applying it to a specific study developed entirely by the senior author, Cledwin Mendoza, himself a middle school student. It is important to keep the nature of the lead researcher in mind because the paper will reveal a way by which the world can be studied from the ‘inside out’, viz., from the mind of young people who are just entering the world, rather than being studied from the ‘outside in’, by professionals who are trying to understand what the young person is thinking, but doing it through a blunt instrument and a blurry lens.

The steps presented below are implemented in an easy-to-use computer program, www.BimiLeap.com. The program is free to use, with the only charges being the minor cost of acquiring information from the artificial intelligence source (Open AI), and the relatively minor cost of actually running a study with real people.

The Steps in the Process

Step 1: Describe the Topic in a Word or Two (Figure 1)

This step may seem simple, but it forces the researcher to focus on the issue. This first step begins the development of critical thinking about the topic, as the research is forced to distinguish between the topic in general (to be written in the proper space in Figure 1), and the actual question about the topic (to be written in Figure 2, where the researcher is requested to expand on the topic.

FIG 1

Figure 1: The front page, requesting the researcher to name the study

Step 2: Come Up with Four Questions Pertaining to the Topic (Figure 2)

It is at this point that many researchers and students ‘freeze.’ It is one thing to name a topic, but quite another to think deeply about a topic, coming up with a set of four questions which are coherent, and which tell a story. The Mind Genomics process has been immeasurably aided by the emergence of artificial intelligence provided by Open AI, Inc., and embedded in Idea Coach. Panel B shows the screen shot with the ‘box’ in which the researcher can describe the topic, either in sketchy terms or in detail, as desired. Idea Coach then returns with a set of up to 30 recommended questions that can be used (Panel 2C). The researcher may select some of the questions, and repeat the request, using either the same description of the topic, or a revised description. Idea Coach will return with another set of 30 questions, some of which may be repeats from the first set of 30. Panel D lists the final set of four questions. The Idea Coach in Step 2 serves both as a tool to facilitate the research and to engage the researcher to think more deeply about the topic. Table 1 presents a set of 30 questions emerging from the request. The entire set-up process takes about 10 minutes or less once the researcher becomes familiar with the process of using Idea Coach. It is important to emphasize that Step 2 enables the researcher to learn about the topic in a way that ends up being deep and granular.

FIG 2

Figure 2: The request for the four questions (Panel A), the Idea Coach (Panel B), some of the questions returned (Panel C), and the four questions finally selected (Panel D).

Table 1: The 30 questions emerging from using Idea Coach

TAB 1

Step 3: Create Four Answers for Each of the Four Questions

Answering questions ends up being easier than posing questions. Once the researcher has chosen the four questions, the researcher can either answer the questions directly, or once again use artificial intelligence embedded in Idea Coach to create the answers. Once again the researcher can use Idea Coach a number of times for each question to identify appropriate answers. Each ‘query’ to Idea Coach returns with 10-15 answers. Depending upon the nature of the topic the answers can be the same or different. There is no direct control. Figure 3 shows the process as the researcher would see it. Table 2 shows three different runs of the same question, creating 45 answers, many of which are the same from run to run.

FIG 3

Figure 3: The instruction to create four answers for Questions

Table 2: Three sets of 12 suggested answers to question 1 provided by Idea Coach. The question is ‘What qualifications are required to become a police officer?”

TAB 2

Step 4: Create Vignettes Comprising 2-4 Elements

Mind Genomics works by presenting vignettes to respondents, these vignettes comprising a limited number of elements. The vignettes attempt to describe a ‘scenario’ with sufficient information to allow the respondent to assign a rating. The vignettes are created according to an underlying experimental design. The design for the specific set of four questions and four answers to each question requires 24 combinations. These combinations can be modified by a permutation scheme, one which maintains the underlying mathematical structural, but ensures that each set of 24 combinations differs substantially from every other set of 24 combinations. Each of the 16 elements in the 24 combinations appears exactly five times, and is absent exactly 19 times. Each vignette comprises at most one element or answer from a question, never two answers from the same question, and in five of the 24 vignettes the element or answer from the question is entirely absent.

Figure 4 shows an example of the vignette (and the rating question and scale) as it would be presented to the respondent. The respondent does know that the vignettes are created by an underlying design, and indeed it would be impossible for the respondent to detect such a design in the short time that the respondent participants.

FIG 4

Figure 4: Example of the vignette as the respondent sees it. The figure shows the rating question, the vignette

Step 5: Complete the Study set-up

The set-up includes the creation of a set of self-profiling classification questions, two fixed (gender, age), and up to eight more left to the researcher. The rest of the study includes the rating question, the rating scale, an open end-question if desired, and a small paragraph to record the underlying objective of the study. Table 3 shows the relevant information for the study, including the number and gender of the respondents. This information is returned in the Excel report which summarizes the study and its data. Once the study is finalized, the researcher launches, choosing either paid respondents, or respondents that will be furnished by the researcher (Figure 5). Although it is always more attractive to work with one’s own associates/friends/students as respondents, experience suggests that study with 100 respondents may take an hour or two to complete with ‘paid respondents’, and a week or two or even longer, sometimes never, to complete with one’s ‘unpaid respondents.’

Table 3: Relevant study information for the study returned in the Excel report

TAB 3

FIG 5

Figure 5: Options to source respondents from (www.BimiLeap.com, the Mind Genomics website

Step 6: Sourcing Respondents

During the past decade the volume of surveys has increased dramatically, as the desire for consumer feedback has exploded. Consequently, the so-called ‘response-rate’ has dropped down. Whereas decades ago the participation in a survey was deemed interesting, today the same participation is considered an intrusion. It is difficult, almost impossible at times, to secure respondents for free, unless one is dealing with a captive audience. The best way to get willing respondents is to pay them, or to work with an on-line panel provider who incentivizes the respondent to participate in these surveys, e.g., through points which can be redeemed for something, even occasionally for money. Whether these respondents are somehow biased or not representative of the ‘real world’ was once an issue for the purist researcher, but today’s oversampled, survey-weary individuals make that issue of ‘real world’ virtually irrelevant.

The BimiLeap program has within it a variety of options to source respondents, as Figure 5 shows. The efforts to source respondents do cost some money, but minimal amounts in the world of today. For those who want to source their own respondent there is that option. For those who want a professional group to provide a group of specified types of individuals there is that option as well.

Step 7: Acquiring the Data and Storing the Data in an Analysis-ready Database

The respondents were provided by Luc.id, Inc. BimiLeap contains a set of screens allowing the researcher to specify the respondents. For this study, the respondents were selected to be residents of the United States, and to be between the ages of 16 and 30. The BimiLeap program is set up to forward the request automatically to Luc.id, when the researcher selects BimiLeap as the provider.

The appropriate respondents who fit the criteria selected by the researcher are invited to participate. Those who participate are shown a series of screens, introducing the topic, requesting the respondent to complete the self-profiling questionnaire, and then read and rate each of the 24 vignettes. Recall that each respondent evaluated a unique set of 24 vignettes, as specified by the underlying experimental design [13].

Figure 6 shows an example for three vignettes evaluated by one of the respondents. The left column shows the respondent (cut off for this respondent), the 2nd column shows the text of the vignette, the 3rd column shows the rating, and the 4th column shows the response time.

FIG 6

Figure 6: Example of data as captured by the Bimileap program

Step 8: Create Equations Relating the Presence/Absence of Elements to Ratings and to Response Time

The goal of Mind Genomics is to quantify the relation between the presence/absence of the elements and the response. The response in this case is the rating assigned by the respondent on the 5-point scale (or more correctly a transformed value, described below), and well as the response time.

The first action to create the equations is to put the rating into the proper form. The scale by itself has to be transformed so that the numbers are meaningful. The scale as presented is known as a nominal scale. The scale does not have metric meaning. Fortunately, the transformations that can be made are easy to do, as presented below.

For this study we focus on Rating 5. The rating question is: Are cops the most powerful and strongest people to catch criminals? Rating 5 is: They are both the most powerful and strong.

Our interest then is whether the respondent feels that that, based on the vignette, does the respondent rate the vignette ‘5’ or not. When the respondent rates the vignette ‘5’, then we create a new variable, called R5, and give R5 the value ‘100’. When the respondent rates the vignette ‘1, 2, 3 or 4’, then we give R5 the value ‘0’. In this way we end up with a new variable ‘5’ which has a defined, straightforward meaning. Furthermore, a manager presented with an average value of 45 for R5, for example, the manager immediately knows that 45% of the responses were ‘5’, and the remaining 55% of the responses were not ‘5’. Note that in this study only the rating of ‘5’ was transformed to 100, with the remaining four rating points transformed to ‘0’. In other studies, often the ratings of both ‘5’ and ‘4’ are transformed to 100. The reason for the focus on rating ‘5’ is the interest in perceiving the police officer as both powerful and strong. Finally, after the binary transformation has been made, a vanishingly small random number is added to the transformed number, moving it away from purely ‘0’. This action is prophylactic, preventing the respondent from ending up with all ‘0’s,’ or with all ‘1’s,’ respectively, a situation which would cause the regression program to ‘crash.’ The regression program requires some minimal level of variation in the dependent variable.

The second action is to bring in the response time and truncate it to the nearest 100th of a second. There is no transformation needed here.

Once the transformations are made, the database can be easily created. Each respondent generates 24 rows in this database. The columns are defined as follows:

Column 1              Study name

Column 2              Respondent unique identifier

Columns 3-5       Specific information from the self-profiling classification (here gender, age, and appropriate age…)

Column 6-21      Coding for the element. Each column corresponds to an element (A1-D4). For a specific respondent and a specific vignette, the cell has the value ‘1’ when the element appears in the vignette, or the value ‘0’ when the element is absent from the vignette.

Column 22            Order of testing (1-24)

Columns 23-24    Rating, Response Time,

Columns 25-29 Binary Transformed Ratings (R1, R2, R3, R4, R5)

Once the data are transformed, it is straightforward to create the equation relating the presence/absence of the 16 elements to the transformed (binary) variable for R5, and to response time. The approach is known as OLS, ordinary least-squares, with the variables being known as ‘dummy variables,’ because the variables are either ‘0’ (absent) or ‘1’ (present).

The regression equation for R5 (transformed binary rating) is: R5 = k0 + k1(A1) + k2(A2) … k16(D4)

The equation tells us that the binary value R5 is the sum of an additive constant (k0) and the weighted values for the 16 elements. The additive constant is a purely theoretical baseline, showing the expected value of the binary variable R5 when all the 16 elements are absent from the vignette. The reality is that the underlying experimental design ensures that each respondent evaluated vignettes comprising a minimum of two elements and a maximum of four elements, so in no case was a vignette ever shown without elements. Nonetheless, the regression equation estimates that value, as a ‘correction factor’. IN the language of statistics, k0 is known as the ‘intercept’, viz the value of Y when X is 0, or in our case the value of R5 when all the 16 X’s, the 16 elements, are 0. We use the value R5 as a measure of the basic predilection of a person or a group of respondents to select the rating of ‘5’.

The coefficient for an element (viz., k1 – k16) tells us the percentage of respondents who will change their rating to ‘5’ when they evaluate a vignette with the element in the vignette. Thus, for a coefficient of 3 for an element, an additional 3% of the respondent who read a vignette with that particular element changed their rating from ‘1, 2, 3 or 4’ to a rating of ‘5’. Our focus will be on the elements and the subgroups showing high coefficients, typically 6 or higher. Continuing with our train of thought, a coefficient of +6 for an element means that an additional 6% of the responses for a vignette containing this element will shift from a lower range of 1-4 to the higher value of 5.

The regression for RT (response time) is expressed by the same equation, but without an additive constant: RT = k1(A1) + k2(A2) … k16(D4). Response time does not need an additive constant. We assume that in the absence of all elements there is no response at all, so by definition the response time is already 0.

Step 9: Create Mind-sets Using Clustering

People are different. We often pay attention to the large differences among people, feeling that these are worthy of note. Marketers attempt to divide the world into these different basic groups, the groups being relevant to large-scale topics and issues such as political leaning (e.g., progressive vs. conservative), financial issues (e.g., growth seeking vs. capital protection), food preferences (adventurous eaters vs. conservative eaters), and the like. The contribution of Mind Genomics is to find these differences in the world of the everyday. An early discovery of Mind Genomics was that it is a straightforward approach to uncover these group differences within a single dataset using relatively straightforward statistics.

For our data on police, or for that matter, any data of this type, the process to uncover these mind-sets, these groups of different-thinking individuals, uses a combination of regression analysis and cluster analysis. The overall goal is to create an individual-level equation for each respondent, then using the coefficients of the model for each respondent to define a ‘distance’ between each pair of respondents, and finally put the individuals in a small number of groups or clusters (viz., mind-sets) so that the pattern of coefficients is similar within a group or mind-set, but the groups are different from each other. The outcome, however, ends up being a small number of groups which have radically different patterns of coefficients, patterns which presumably lend themselves to easy interpretation.

The clustering used in this study is called k-means cluster [14]. The clustering approach creates an equation for each respondent, relating the dependent variable, R5, to the 16 elements. The estimation of the individual-level model is possible because the 24 vignettes for each respondent are set up to allow OLS regression for that individual, even if there is no other respondent. The measure of distance between the respondents is (1-Pearson R), with the Pearson R (correlation) measuring the degree of linearity between two sets of 16 coefficients (the additive constant not considered). The distance between two perfectly correlated sets of 16 coefficients is 0 (1-1 = 0). The distance between two opposite patterns is (1)-(-1), viz., 2. Once the person-to-person distances are computed, as well as the centroid-to- centroid differences computed, the clustering program can identify the number of clusters, and the appropriate membership of each respondent in one of the non-overlapping, exhaustive clusters. For these data the cluster solution suggested two groups, called MS1 and MS2 (MS short for mind-set).

Results

Table 4 shows the panel composition:

We begin the exploration of the data with the simplest analysis, namely the average response time, and the average transformed ratings, first for total panel, and then for key subgroups. Table 4 shows the averages. The columns correspond to the dependent variable, the first being the average response time across all vignettes evaluated by the key subgroup, and the remaining five being the average transformed ratings, R1-R5. The final analysis looks at the averages for the first 12 vignettes, and then the second 12 vignettes. To allow patterns to emerge, Table 4 presents strong performing elements in shaded cells. These strong performing elements are response times of 2.6 seconds or longer, and average transformed variable of 24 or higher. The pattern is clear for the order of testing, with vignettes 1-12 generating longer response times than vignettes 13-24. Yet, beyond that simple finding, it is hard to state anything about the results. By itself, Table 5 may allow one to generate hypotheses about ‘why’ certain ratings (R5, R2, R1) co-vary with long responses times, whereas other ratings (R4, R3) co-covary with short response times. Table 4, however, does not allow the researcher to exploit the most important feature of the stimuli, viz., that the test stimuli, the elements, are ‘cognitively rich,’ replete with meaning, and interpretable in and of themselves.

Table 4: Panel composition

TAB 4

 

We now move to the explication of the data after OLS (Ordinary Least Squares) regression. The dependent variable is R5, The rating question is: Are cops the most powerful and strongest people to catch criminals? Rating 5 is: They are both the most powerful and strong. R5 takes on the value ’100’ when the respondent selects ‘5’ as the rating. R5 takes on the value ‘0’ when the respondent selects any other number, ‘1, 2, 3, or 4’.’

The coefficients for the equation (models) for the studies are shown in Table 5. The columns correspond to the defined groups of respondents or vignettes, the rows correspond to the additive constant, and then to the 16 elements. All coefficients of 1 or lower are removed, so that the cell is empty. Strong performing elements (operationally defined as a coefficient of +6) are shown by shaded cells. The table is sorted by the values for the coefficients emerging from the mind-sets.

Table 5: Average response time and transformed binary variable for total panel and key subgroups

TAB 5

The rationale for not showing very low, 0 or negative coefficients is that these negative coefficients show that the element does not drive R5. We are interested in the elements which drive R5. The rationale for shading the strong performing cells is to allow the patterns to emerge more clearly. Finally, the rationale for sorting the table by the coefficient of the two mind-sets that only then does a strong and meaningful pattern emerge.

Table 6 shows four sets of columns, corresponding to the key groups.

  1. The additive constant is 18, meaning that about one out of five or six responses is ‘5’. This is a low baseline. As we scan the table, looking at the column for Total, see remarkably few elements. It is as if there are no strong messages. It is important to stop to think about what this means. Is it the case that the researcher simply failed to find the ‘right words’ to drive the strong responses? Or is the reason deeper, that perhaps looking at the Total is not a productive approach, that perhaps there will never be the ‘magic messages’ which generate high coefficients among the total panel. It is important to note that this conundrum, about low coefficients among the total panel, is a lesson for the young researcher that there is no perfect message, and that it might be futile to continue in that path, looking for the ‘better message’. Finally, the disappointing results for the Total Panel do not surprise us. They emerge again and again in these studies and in the outside where the data are used to make product development and marketing decisions. There are no ‘perfect’ and when a high scoring element is achieved for the Total Panel, it is an unexpected anomaly.
  2. Once again, the additive constants are low, 16 for males, 18 for females. And once again most coefficients are absent. There are few positive coefficients and no operationally defined ‘strong performing elements’ with coefficient of +6 or higher.
  3. It is when we get to age that we begin to see patterns emerging, patterns which show us different ways of thinking. When we look at these patterns in detail, however, we will see that the patterns emerge from the general magnitudes of the response, and not from profoundly different ways of looking at the work. The key to the differences among the different elements which perform strongly can be traced to the size of the additive constant. The additive constant is very low for ages 15-19, and for ages 25-30. The basic tendency is low for a vignette to get the rating ending up as R5, viz., and original rating of ‘5’. Consequently, it is much easier for an element to generate a high positive coefficient when the additive constant is low. Think of an element with coefficient 14, but with additive constant 4 as not really that different from an element with coefficient 2 but additive constant 16. Both sum to 18. The former element is a strong performer. The very low base does nothing to help the elements score well. This element scores well without any help. Now let’s turn to the second, from a data set with a higher additive constant, 16. All elements benefit from this higher additive constant. A poor element with an intrinsic value of +2 will have the benefit of added to a high base.

Nonetheless, there are patterns.

Age 15-19 – very low additive constant (5), so three elements stand out

B1               Qualifications needed: Criminal justice degree or related field                       13

D4               How long it takes to become a police officer: Depends on the individual’s background, experience, and qualifications.                          12

B4               Qualifications needed: At least 1 year of college                                              7

Age 20-24 – modest additive constant (26), so no element stands out.

Age 25-30 – very low additive constant (1), so four elements stand out

D2            How long it takes to become a police officer: Most police academies require a minimum of around 800 hours of training before one can become a police officer.                             13

A1             Qualifications needed: Be at least 21 years old                                                   9

A2             Qualifications needed: Pass a criminal background check                                9

A4             Qualifications needed: Complete an academy training program                      7

It is with the creation of the two mind-sets that we see strong performing elements, and two clear patterns. Recall that the clustering was done without any interpretation of the results. Only after the clustering was complete was the data reanalyzed by OLS regression, with a separate equation for each mind-set. Table 6 shows that the two mind-sets each have modest additive constants (15 and 21, respectively), and more important, the strong performing elements for each mind-set tell a coherent story.

Mind-Set 1 focus on time to become a police officer.

D2 How long it takes to become a police officer: Most police academies require a minimum of around 800 hours of training before one can become a police officer.                                   12

D4 How long it takes to become a police officer: Depends on the individual’s background, experience, and qualifications.                                                                                                          9

D3 How long it takes to become a police officer: The amount of time needed to complete the police academy, along with any additional training or certifications required by the jurisdiction, will vary.   8

D1 How long it takes to become a police officer: Anywhere from six months to two years.        7

Mind-Set 2 focuses on the qualifications to become a police officer

B1        Qualifications needed: Criminal justice degree or related field                                      9

A3        Qualifications needed: Pass a drug test                                                                           7

B4        Qualifications needed: At least 1 year of college                                                             7

B2        Qualifications needed: Post-secondary certification or degree                                     6

Table 6: Additive constant and coefficients for equations relating R5 to the presence/absence of the 16 elements

TAB 6

We finish the presentation of results and the analysis by considering the data from the point of view of response time (RT). Response time occupies a special position in psychology and consumer / public opinion research [15]. It is presumed by some reearchers that a lot can be learned by measuring ‘responses’ that cannot be consciously controlled. Response time to the stimulus is one of these measures, albeit very closely related to the stimulus, and thus a reasonable choice for a non-conscious measure, one step beyond the direct rating which is assumed to be a conscious measure measure.

Table 7 shows the coefficients from the group-level equations relating response time (RT) to the presence/absence of the 16 elements. As noted above, the equation is estimated without an additive constant. In ‘regression speak’ this is known as ‘forcing the equation through the origin.’ All coefficients 1.0 seconds or longer are shown in shaded cells. Finally, the table shows the elements sorted by decreasing response time.

There are some clear patterns emerging from Table 6, patterns which make sense,

There is a clear hierarchy of response times

B4           Qualifications needed: At least 1 year of college                                              1.0

D1           How long it takes to become a police officer: Anywhere from six months to two years.       0.4

There is one element, B4, which is consistently among the longest in every group, suggesting that the respondents think about this element. This element reads: Qualifications needed: At least 1 year of college.

In contrast, the elements dealing with ‘how long it takes to become a police officer’ generate the shortest response times among all groups.

The practical aspects of the response time data emerge when we think about the implications. If the objective is to convey relevant information, long response times are important. They figuratively ‘stop the reader in her/his tracks,’ engaging the reader. The information is important to the reader, forcing the reader to think about what was read.

Table 7: Coefficients for equations relating response time (RT) to the presence/absence of the 16 elements

TAB 7

Discussion and Conclusions

A glance through the various references suggest that researchers are aware of the need to understand careers from the mind of students [16,17], but often approach the issue from the ‘top down.’ That is, the researcher is the adult, asking the younger person about ‘why did you want to become a police officer?’ The top-down approach is hallowed in research, with the topic-experts investigating the topic at a distance.

What is missing from the foregoing approach is a sense of what the young person is thinking. The young person can only respond to questions formulated by individuals who are ‘outside’ them, probing them to understand how the young person thinks. One need only look at the published research about young people and police to realize that virtually all information is top-down [18,19].

This paper has presented a novel way to understand how young people think about a career. The novelty comes from the use of young people as researchers, as well as using other young people as respondents. The scientific community is accustomed to researchers being topic-experts, focusing their inquiry into a problem, after having formulated hypotheses.

The ability to make students into researchers emerges from the combination of a research approach (experimental design), coupled with a templated approach guiding the user (www.BimiLeap.com, embodying Mind Genomics), and with artificial intelligence to suggest ideas (Idea Coach). The result of this happy combination is that virtually any young person who can read and understand instructions can become a researcher. The benefit is that the topic can be investigated by those who are also most heavily involved. The researcher needs not be mature, nor be a topic expert. As long as the researcher knows what to do, the approach is straightforward. The technology is set up so that no adult has to be involved, either in the design of the study, or in the completion of the study. That simplification, allowing anyone to become a researcher, opens the possibility of far deeper understanding of the way children think, not so much from better theory as from the ability to give the mind of the child a way to explore topics in the form of an experiment, with answers from other qualified respondents appropriate to the study.

References

  1. Barthe EP, Leone MC, Lateano TA (2013) Commercializing success: The impact of popular media on the career decisions and perceptual accuracy of criminal justice students. Teaching in Higher Education 18: 13-26.
  2. Fekjær SB (2014) Police students’ social background, attitudes and career plans. Policing: An International Journal of Police Strategies & Management 37: 467-483.
  3. Howard KA, Walsh ME (2010) Conceptions of career choice and attainment: Developmental levels in how children think about careers. Journal of Vocational Behavior 76: 143-152.
  4. Kupchik A, Curran FC, Fisher BW, Viano SL (2020) Police ambassadors: Student‐police interactions in school and legal socialization. Law & Society Review 54: 391-422.
  5. Powell MB, Skouteris H, Murfett R (2008) Children’s perceptions of the role of police: a qualitative study. International Journal of Police Science & Management 10: 464-473.
  6. Sindall K, McCarthy DJ, Brunton-Smith I (2017) Young people and the formation of attitudes towards the police. European Journal of Criminology 14: 344-364.
  7. Moskowitz HR, Gofman A, Beckley J, Ashman H (2006) Founding a new science: Mind genomics. Journal of Sensory Studies 21: 266-307.
  8. Moskowitz HR, Gofman A (2007) Selling Blue Elephants: How to Make Great Products that People Want Before Theu Even Know They Want Them. Pearson Education.
  9. Gabay G, Moskowitz HR (2015) Mind Genomics: What Professional Conduct Enhances the Emotional Wellbeing of Teens at the Hospital? Journal of Psychological Abnormalities in Children.
  10. Gofman A, Moskowitz HR, Mets T (2011) Marketing museums and exhibitions: What drives the interest of young people. Journal of Hospitality Marketing & Management 20: 601-618.
  11. Mukerjee R, Wu CF (2006) A Modern Theory of Factorial Design. New York: Springer.
  12. Mendoza C, Deitel J, Braun M, Rappaport S, Moskowitz H (2023) Empowering Young Researchers: Exploring and Understanding Responses to the Jobs of Home Aide for a Young Child. Pediatric Studies and Care 3: 1-9.
  13. Gofman A, Moskowitz H (2010) Isomorphic permuted experimental designs and their application in conjoint analysis. Journal of Sensory Studies 25: 127-145.
  14. Likas A, Vlassis N, Verbeek JJ (2003) The global k-means clustering algorithm. Pattern Rrecognition 36: 451-461.
  15. Bassili JN, Fletcher JF (1991) Response-time measurement in survey research a method for CATI and a new look at nonattitudes. Public Opinion Quarterly 55: 331-346.
  16. Clinkinbeard SS, Solomon SJ, Rief RM (2021) Why did you become a police officer? Entry-related motives and concerns of women and men in policing. Criminal Justice and Behavior 48: 715-733.
  17. Durkin K, Jeffery L (2000) The salience of the uniform in young children’s perception of police status. Legal and Criminological Psychology 5: 47-55.
  18. Ho T (1999) Assessment of police officer recruiting and testing instruments. Journal of Offender Rehabilitation 29: 1-23.
  19. Kanable R (2001) Strategies for recruiting the nation’s finest. Law Enforcement Technology 28: 64-68.

Τhe Relationship between Smoking and Emotional Intelligence in Patients with Coronary Artery Disease

DOI: 10.31038/PSYJ.2023524

Abstract

Background: Several studies have found an inverse relationship between emotional intelligence and smoking behavior.

Purpose: The purpose of the research is to examine this relationship.

Methods: The questionnaires used in this research were the following: a demographic questionnaire, the Smoking in psychiatric hospitals-a survey of patients’ views, and the TEIQue-SF in order to measure emotional intelligence. The research was conducted on a sample of 152 patients at the Cardiology Clinic of the National University of Athens “Sotiria”.

Results: The results indicated that there was a negative statistically significant relation between emotionality and well-being were inversely related to years of smoking and number of cigarettes per day, but a positive statistically significant relation between emotionality and well-being with the age the sample began to smoke. In addition, a statistically significant positive relationship was found between sociability and number of cigarettes/day.

Conclusions: Overall, therefore, it cannot be argued that higher levels of emotional intelligence are related to more positive smoking behaviors such as frequency and age of smoking initiation. Nevertheless, there are indications that emotional intelligence can be an important factor that can reduce the frequency of smoking and strengthen a positive behavior towards stopping this habit. For this reason, it is proposed to design and implement educational programs that aim to strengthen and utilize emotional intelligence, both at the level of prevention and treatment of smoking. However, further studies in a more representative sample of the population are necessary.

Introduction

Cardiovascular diseases are associated with significant morbidity and mortality and are associated with a significant financial burden on health care systems worldwide [1]. Cardiovascular diseases refer to a set of disorders of the heart and blood vessels and include, among others, coronary artery disease [2]. Due to the negative impact of these diseases on the individual and on society as a whole, the importance of early detection and prevention of risk in the appropriate age and risk groups is highlighted, with the aim of implementing interventions that can reduce the risk of developing these diseases. On the one hand, an inverse relationship has been demonstrated between emotional intelligence and cardiovascular disease [3,4], as well as specific health outcomes related to coronary heart disease [5], such as reduced blood pressure. On the other hand, an inverse relationship has also been indicated between emotional intelligence and smoking, which is an important risk factor for coronary heart disease [6-9].

Emotional intelligence is related to the individual’s ability to accurately perceive, evaluate, manage and express his/her emotions [10,11]. Overall, emotional intelligence is defined as the ability to accurately perceive, understand, evaluate, and express emotions, with this emotional knowledge influencing individuals’ thinking and behavior [12]. Emotional intelligence mainly includes a person’s achievement, adaptability, emotional self-awareness, empathy, mood regulation/self-control, self-evaluation, cognitive ability, conceptual thinking, problem solving, and stress management [13]. Therefore, emotional intelligence is characterized by a series of skills: a) perception, evaluation and expression of emotion, which includes recognition of both one’s own emotions and the emotions of others, as well as the ability to express them; b) understanding and analysis of emotions, which allows one to characterize them and understand the relationships between them, as well as the situation that created them; c) control of emotions, the ability to regulate and control the emotions of both one’s own person and others.

Consequently, the ability to monitor and use information about one’s emotions is important in the context of health behavior, as it can be used to guide thoughts, attitudes, and perceptions [14-16]. It is a psychological mechanism capable of enhancing positive behavioral changes, as it is based on the ability of a person to deal with negative emotions, the ability to appropriately manage peer pressure to engage in a behavior (e.g. smoking), but also the potential to discourage addiction various substances, such as nicotine. Furthermore, components such as self-control and self-awareness have been found to be effective in reducing individuals’ self-destructive behavior [17-19].

In the international literature, a relationship between emotional intelligence and smoking has been found. For example, high levels of emotional intelligence have been found to be a protective factor for smoking [20] and be associated with lower smoking frequency [21]. In addition, emotional intelligence is inversely related to age of smoking initiation. Moreover, it has been found that people with a higher level of emotional intelligence are governed by better perceptions of the negative social consequences of smoking, greater self-confidence to refuse an offer and peer pressure to smoke, and therefore less intention to smoke [22]. Overall, several studies have found an inverse relationship between emotional intelligence and smoking behavior [23,24].

Regarding the impact of demographics, the findings of previous studies lead to ambiguous results. More specifically, it has been found that gender plays a role in the relationship between emotional intelligence and smoking, while age has not been found to have an effect. Apart from demographic data, stress has been found to be an important factor related both to smoking behavior itself [25], and to the relapse of people who have stopped smoking, as it is considered as a coping mechanism for stressful situations. Additionally, it has been found that personality type, paranoid beliefs and anxiety in combination with coping methods, but also emotional intelligence are related to psychopathology in patients with coronary artery disease [26].

Aim and Research Hypotheses

The purpose of the research is to examine the relationship between smoking and emotional intelligence in patients with coronary artery disease. Based on the findings of the international literature stated above, the research hypotheses formulated are the following:

H1: There is an inverse relationship between emotional intelligence and age of smoking initiation.

H2: There is an inverse relationship between emotional intelligence and the number of cigarettes per day.

Material and Method

Sample

Convenience sampling was used as the sampling method. More specifically, the researcher addressed to the Cardiology Clinic of the public hospital ‘Sotiria’ in Athens, Greece. A total of 155 questionnaires were distributed to patients, of which 152 were completed. All questionnaires were valid. The questionnaire was accompanied by a participant information and consent form. Approval permission was received from the Board of Directors of the hospital, under application protocol no. 16773/24-6-21 and a hospital license no. 17810/6-7-21 was also obtained.

Smoking Questionnaire

The Smoking in psychiatric hospitals-a survey of patients’ views questionnaire was used [27]. This questionnaire includes the following sections:

  • Demographic and smoking information: Name, age, gender, place of birth, residence, marital status, number of children, educational level, occupational status, number of cigarettes per day, age of initiation, years of smoking, duration of smoking cessation, family history of psychiatric disorders.
  • Smoking history: Information about individuals’ smoking history and whether there have been periods when they had stopped smoking, reasons that encourage or discourage smoking cessation, as well as existing conditions related to smoking.
  • Smoking and health: The following factors were examined: Age of smoking initiation, reasons for initiation, number of cigarettes per day, type of cigarette, knowledge of the harmful effects of smoking, and comorbidity.

Emotional Intelligence Questionnaire

The TEIQue-SF questionnaire [28] was chosen in order to measure emotional intelligence. It consists of a total of 30 questions grouped into four categories (well-being, self-control, emotionality, sociability), as shown in Table 1. The answers are given on a seven-point Likert scale from 1 (strongly disagree) to 7 (strongly agree). The Cronbach’s a index demonstrated a high level of internal reliability overall for the scale (0.944).

Table 1: Calculation and reliability of TEIQue-SF scales

Subscale

Questions

Reliability

Well-being (5+9+12+20+24+27)/6

0.895

Self-control (4+7+15+19+22+30)/6

0.660

Emotionality (1+2+8+13+16+17+23+28)/8

0.883

Sociability (6+10+11+21+25+26)/6

0.858

Statistical Analysis

Statistical analysis was performed with the Statistical Package for Social Science (SPSS) version 21. Descriptive and inferential statistics (correlations) were used.

Results

Demographic Data

The majority of the participants are men (67.8%), with an average age of approximately 62 years (M=61.9), graduates of higher education (42.1%), married (70.4%), with two children (44.7%), who are currently working (61.8%) (Table 2).

Table 2: Respondents’ demographic data

 

N (Mean)

% (SD)

Gender Man

103

67.8

Woman

42

27.6

No response

7

4.6

Age

(61.9)

(7.7)

Education Basic education

48

31.6

High school

18

11.8

University degree

64

42.1

Master/PhD

20

13.2

No response

2

1.3

Marital status Single

20

13.2

Married

107

70.4

Divorced

12

7.9

Widow

7

4.6

No response

6

3.9

Number of children 0/No response

24

15.7

1

16

10.5

2

68

44.7

3

39

25.7

4

5

3.3

Occupation Unemployed

3

2.0

Household

9

5.9

Retired

46

30.3

Currently employed

94

61.8

Family history of psychiatric disorders Yes

18

11.8

No

95

62.5

No response

39

25.7

Smoking Habits and Smoking History

Most of the participants, 98.7% (N=150), stated that they have smoked in their lifetime, while 97.4% (N=148) were smoking during the survey period. Moreover, 72.4% (N=110) stated that they have never tried to quit smoking, while of those who answered positively, they stopped smoking for an average of 4.6 years (M=55.4 months). Of those who answered positively that they smoke during this period, the average age of starting smoking was 18 years (M=17.7) and therefore the average number of years of smoking is 43 (M=43), while the average number of cigarettes per day is 20 (M=20.1). Regarding the reasons for starting smoking, social influence (43.4%), curiosity (24.3%), “fashion” (19.7%), as well as stress and personal problems (10. 5%). Finally, the cigarettes that are preferred are filtered (88.2%) versus unfiltered (1.3%) and twisters (7.2%) (Table 3).

Table 3: Smoking habits and smoking history

 

N

Minimum

Maximum

M

SD

Number of cigarettes per day

152

10

40

20.1

6.2

Age of smoking initiation

152

15

24

17.7

1.5

Years of smoking

151

26

60

43

8.2

Duration of smoking cessation (in months)

17

5

192

55.4

43.9

Opinions/Attitudes about Smoking Cessation

Based on the results, 94.7% of respondents stated that their doctor advised them to stop smoking immediately. Also, 75% believe that smoking harms their health a lot, compared to 21.1% who said that smoking harms their health to a small extent. Moreover, 53.3% of respondents stated that it is very difficult to quit smoking. Regarding the reasons, smoky atmosphere (65.2%), seeing other patients (52%) and staff (52.6%) smoking were mentioned to a very, very large extent. It should be noted that 9.2% stated as additional reasons stress and/or habit. In addition, 62.8% (N=94) of the respondents stated that they would need help to stop smoking and mainly nicotine substitutes – mastics and stickers (47.4%). It is noteworthy that 34.2% (N=52) admitted that they do not want help, but that quitting smoking depends only on their own will.

Hospital Smoking Policy

According to the statistical analysis, 81.6% see staff smoking at work and specifically outside (78.3). 43.4% of respondents believe that staff should not be allowed to smoke at work. It was also mentioned that staff (86.8%) and visitors (87.5%) should not smoke together with patients. Moreover, 50.7% consider that the rules for smoking in the department are very/very high. Furthermore, 99.3% believe that staff should encourage smokers to stop/cut down and 63.8% that it is important for staff members to lead by example.

Moreover, 89.5% know who the reference person is and 85.6% state that the reference person smokes. 73.7% disagree that they would trust a non-smoking referent more than a smoker, while 75.7% disagree that they can work better with a smoking referent than a non-smoker.

Emotional Intelligence

All subscales of emotional intelligence range at above average levels. A higher mean was found in the subscale of sociability (M=4.9, SD=1), then well-being (M=4.9, SD=.8), then emotionality (M=4.7, SD=1) and finally self-control (M=4, SD=.9) (Table 4).

Table 4: Descriptive statistics of emotional intelligence subscales

 

Minimum

Maximum

M

SD

Well-being

2.8

6.7

4.9

0.8

Self-control

2

6.3

4

0.9

Emotionality

2.5

6.9

4.7

1

Sociability

2.3

7

4.9

1

Smoking and Emotional Intelligence Relation

Using the Spearman coefficient, the existence of a correlation between emotional intelligence and age of onset, number of cigarettes/day and years of smoking was examined (Table 5). At a significance level of α=.01, a statistically significant negative correlation was found between emotionality and the number of cigarettes/day (p<.01) and a statistically significant positive correlation between emotionality and age of smoking initiation (p<.05=1). At a significance level of α=.05, a statistically significant negative correlation was found between well-being and years of smoking (p<.05), as well as a statistically significant positive correlation between well-being and the age at which smoking began (p<.05), but also between sociability and the number of cigarettes/day (p<.05).

Table 5: Correlations between smoking and emotional intelligence (N=150)

Cigarettes/day

Age of onset

Years of smoking

Well-being

-0.14

0.18*

-0.19*

Self-control

-0.25**

0.15

-0.01

Emotionality

-0.33**

0.23**

-0.12

Sociability

0.17*

-0.11

0.02

*Correlation is significant at .05 level (2-tailed)
**Correlation is significant at .01 level (2-tailed)

Discussion

From the statistical analysis it was found that while the doctor has advised almost all patients to stop smoking and that while almost everyone knows that smoking greatly damages their health, the vast majority continue to smoke, as it is too much for them/very difficult to stop this habit. All study participants started smoking during adolescence/early adulthood, which has been reported by other studies. Stress was found to be a factor associated with the smoking habit.

The results regarding the relationship between emotional intelligence and the history and habits of smokers are interesting. More specifically, a statistically significant negative correlation was found between emotionality and number of cigarettes/day, as well as between well-being and years of smoking. Therefore, dimensions of emotional intelligence are inversely related to years of smoking and number of cigarettes per day, which is consistent with what has been reported by other scholars [29]. However, a positive correlation was also found between emotionality and age of smoking initiation, between well-being and age of smoking initiation, and between sociability and number of cigarettes/day. Therefore, dimensions of emotional intelligence are associated with a positive relationship with age of smoking initiation and number of cigarettes per day, which is contrary to what has been found in previous research. Also, self-control, emotionality and sociability were not found to be correlated to a statistically significant degree with years of smoking, while no correlation was found to a statistically significant degree between self-control-age of smoking initiation and sociability-age of smoking initiation.

Overall, therefore, it cannot be argued that higher levels of emotional intelligence are related to more positive smoking behaviors such as frequency and age of initiation, as has been supported by various studies in the past [30,31]. Possibly these results can be interpreted considering the moderate level of emotional intelligence found in the participants of the present research. The characteristics of the specific patient sample (e.g., older age and therefore more years of smoking) may be another reason why the findings of this study partially contradict the findings of earlier studies, considering that smoking it is also a habit that is difficult to break, especially after several years of smoking.

Conclusions and Suggestions

Even though the findings of this research are not entirely consistent with the findings of previous studies regarding the inverse relationship between emotional intelligence and smoking, there are indications that this relationship is partially valid. This means that emotional intelligence can be an important factor that can reduce the frequency of smoking and strengthen a positive behavior towards stopping this habit.

Consequently, emotional intelligence training can effectively facilitate individuals’ adequate adaptation to health conditions [32], while individuals with higher levels of emotional intelligence can better benefit from prevention programs. In a previous study, an educational intervention based on emotional intelligence was used to reduce smoking, the results of which showed that it was effective in smoking cessation [33,34]. Overall, it has been reported by various scholars that educational programs based on emotional intelligence can be beneficial for reducing smoking dependence and overall adopting behaviors that reduce smoking intention. In addition, stress management training and training aimed at enhancing emotional intelligence have been suggested to lead to a reduction in psychopathology in patients with coronary artery disease. Therefore, it is proposed to design and implement educational programs that aim to strengthen and exploit emotional intelligence, both at the level of prevention and treatment of smoking.

However, further research is needed in the Greek population, especially considering that the sample of this paper consists mostly of old-aged men. The composition of the sample and its origin from a specific department of a specific nursing unit limit its representativeness and therefore the generalizability of the results does not exist and therefore, a more representative sample of the population is necessary.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

References

  1. Gautam N, Saluja P, Malkawi A, Rabbat MG, Zhang Y, Lee BC, Al’Aref SJ (2002) Current and Future Applications of Artificial Intelligence in Coronary Artery Disease. Healthcare 10. [crossref]
  2. Appleton AA, Kubzansky LD (2014) Emotion regulation and cardiovascular disease risk. In: J. J. Gross (Ed.), Handbook of Emotion Regulation. The Guilford Press.
  3. Vlachakis D, Vlachakis C (2014) Understanding of emotions and cardiovascular related diseases. PeerJ PrePrints.
  4. Vlachaki C, Maridaki Kassotaki K (2013) Coronary Heart Disease and Emotional Intelligence. Global Journal of Health Science 5: 6: 156: 165.
  5. Kravvariti E, Maridaki-Kassotaki K (2010) Emotional Intelligence and Coronary Heart Disease: How Close Is the Link? Global Journal of Health Science 2: 1, 127: 137. [crossref]
  6. Banks E, Joshy G, Korda RJ, Stavreski B, Soga K, Egger S, et al. (2019) Tobacco smoking and risk of 36 cardiovascular disease subtypes: fatal and non-fatal outcomes in a large prospective Australian study. BMC medicine 17: 1. [crossref]
  7. Salehi N, Janjani P, Tadbiri H, Rozbahani M, Jalilian M (2021) Effect of cigarette smoking on coronary arteries and pattern and severity of coronary artery disease: a review. The Journal of International Medical Research 49: 12,
  8. Stallones, RA (2015) The association between tobacco smoking and coronary heart disease. International Journal of Epidemiology 44: 3, 735:743
  9. Yadegar Tirandaz S, Sahebihagh MH, Namdar Areshtanab H, Jafarizadeh H, Asghari Jafarabadi M (2020) Nicotine Dependency and Its Relationship With Emotional Intelligence Among Male Smoker Employees. Journal of Research & Health 10: 3, 159: 166.
  10. Salovey P, Mayer J (1990) Emotional intelligence. Imagination, Cognition and Personality 9: 3, 185-211.
  11. Trinidad DR, Johnson CA (2002) The association between emotional intelligence and early adolescent tobacco and alcohol use. Personality and Individual Differences 32: 1: 95:
  12. Mayer JD, Salovey P (1997) What is emotional intelligence? In: P Salovey D Sluyter (Eds.), Emotional development and emotional intelligence: implications for educators. New York: Basic Books.
  13. Bar-On R (2001) Emotional intelligence and self-actualization. In: Ciarrochi JP, Forgas Mayer (Eds.), Emotional intelligence in everyday life: A scientific inquiry. New York: Psychology Press.
  14. Bhochhibhoya A, Branscum P (2015) Emotional intelligence: a place in public health promotion and education. Paediatric 3: 2.
  15. González-Yubero S, Lázaro-Visa S, Palomera Martín R (2020) The Protective Association of Trait and Ability Emotional Intelligence with Adolescent Tobacco Use. International Journal of Environmental Research and Public Health 17. [crossref]
  16. Schutte NS, MalouffJ M, Thorsteinsson EB, Bhullar N, Rooke SE (2007) A meta-analytic investigation of the relationship between emotional intelligence and health. Personality and Individual Differences 42, 921: 933.
  17. Li GS F, Lu FJ, Wang H (2009) Exploring the relationships of physical activity, emotional intelligence and health in Taiwan college students. Journal of Exercise Science & Fitness 7: 1, 55: 63.
  18. Hill EM, Maggi S (2011) Emotional intelligence and smoking: Protective and risk factors among Canadian young adults. 2011. Personality and Individual Differences 51: 1, 45: 50.
  19. Louie AK, Coverdale J, Roberts LW (2006) Emotional Intelligence and Psychiatric Training. Academic Psychiatry 30: 1: 3. [crossref]
  20. Limonero JT, Tomás-Sábado J, Fernández-Castro J (2006) Perceived emotional intelligence and its relation to tobacco and cannabis use among university students. Psicothema 18, 95: 100. [crossref]
  21. Trinidad DR, Unger JB, Chou CP, Johnson CA (2004) The protective association of emotional intelligence with psychosocial smoking risk factors for adolescents. Personality and Individual Differences 36: 4: 945: 954.
  22. Perea-Baena, JM, Fernández-Berrocal P, Oña-Compan S (2011) Depressive mood and tobacco use: moderating effects of gender and emotional attention. Drug and Alcohol Dependence 119: 3.
  23. del Mar Molero Jurado M, del Carmen Pérez-Fuentes M, Barragán Martín AB, del Pino Salvador RM, Gázquez Linares JJ (2019) Analysis of the Relationship between Emotional Intelligence, Resilience, and Family Functioning in Adolescents’ Sustainable Use of Alcohol and Tobacco. Sustainability, vol 11.
  24. Tsaousis I, Nikolaou I (2005) Exploring the relationship of emotional intelligence with physical and psychological health functioning. Stress & Health 2: 2 77: 86.
  25. Megías-Robles A, Perea-Baena JM, Fernández-Berrocal P (2020) The protective role of emotional intelligence in smoking relapse during a 12-month follow-up smoking cessation intervention. PLoS One 15: 6.
  26. Shal, RS, Sharbaf HA (2013) Survey the prevalence of psychopathology in Coronary heart disease patients: A casual model based on analysis of the role of psychological factors. Jundishapur Journal of Chronic Disease Care 2: 4 56: 71.
  27. Kourakos M, Kalokairinou A, Zyga S, Koukia E (2016) Views and Attitudes of Patients in Mental Facilities Regarding Smoking. Global Journal Health of Sciences 8: 8. [crossref]
  28. Petrides KV (2009) Psychometric properties of the Trait Emotional Intelligence Questionnaire. In: CStough DH. Saklofske Parker (Eds.), Advances in the assessment of emotional intelligence. New York
  29. Kun B, Demetrovics Z (2010) Emotional intelligence and addictions: a systematic review. Substance Use & Misuse 45: 7-8, 1131-1160. [crossref]
  30. Champeris Tsaniras S, Megalooikonomou V, Vlachakis D (2018) Human Emotions on the Onset of Cardiovascular and Small Vessel Related Diseases. In vivo (Athens, Greece) 32: 4, 859-870. [crossref]
  31. Sharma D, Gulati R, Misra I (2017) Emotional Intelligence: Influencing Smoking Behavior in Young Adults. Jindal Journal of Business Research 6: 1, 14: 24.
  32. Karimzadeh M, Goodarzi A, S (2012) The effect of social emotional skills training to enhance general health & Emotional Intelligence in the primary teachers. Procedia-Social and Behavioral Sciences 46: 57: 64.
  33. Lawrence KC, Egbule EO (2021) Can emotional intelligence training cause a cease in tobacco smoking among school-going adolescents? International Journal of Adolescence and Youth 26: 1, 356-366.
  34. Goleman E (2002) Emotional intelligence, social intelligence, ecological intelligence. New York: Bantam books.