Author Archives: author

Application of Hybrid CTC/2D-Attention End-to-End Model in Speech Recognition during the COVID-19 Pandemic

DOI: 10.31038/MGJ.2021423

Abstract

Recent research in the field of speech recognition has shown that end-to-end speech recognition frameworks have greater potential than traditional frameworks. Aiming at the problem of unstable decoding performance in end-to-end speech recognition, a hybrid end-to-end model of connectionist temporal classification (CTC) and multi-head attention is proposed. CTC criterion was introduced to constrain 2D-attention, and then the implicit constraint of CTC on 2D-attention distribution was realized by adjusting the weight ratio of the loss functions of the two criteria. On the 178h Aishell open source dataset, 7.237% word error rate was achieved. Experimental results show that the proposed end-to-end model has a higher recognition rate than the general end-to-end model, and has a certain advance in solving the problem of mandarin recognition.

Keywords

Speech recognition, 2-Dimensional multi-head attention, Connectionist temporal classification, COVID-19

Introduction

Speech recognition technology is one of the important research directions in the field of artificial intelligence and other emerging technologies. Its main function is to convert a speech signal directly into a corresponding text. Yu Dong et al. proposed deep neural network and hidden Markov model, which has achieved better recognition effect than GMM-HMM system in continuous speech recognition task [1-3]. Then, Based on Recurrent Neural Networks (RNN) [4,5] and Convolutional Neural Networks (CNN) [6-11], deep learning algorithms are gradually coming into the mainstream in speech recognition tasks. And in the actual task they have achieved a very good effect. Recent studies have shown that end-to-end speech recognition frameworks have greater potential than traditional frameworks. The first is the Connectionist Temporal Classification (CTC) [12], which enables us to learn each sequence directly from the end-to-end model in this way. It is unnecessary to label the mapping relationship between input sequence and output sequence in the training data in advance so that the end-to-end model can achieve better results in the sequential learning tasks such as speech recognition. The second is the encode-decoder model based on the attention mechanism. Transformer [13] is a common model based on the attention mechanism. Currently, many researchers are trying to apply Transformer to the ASR field. Linhao Dong et al. [14] introduced the Attention mechanism from both the time domain and frequency domain by applying 2D-attention, which converged with a small training cost and achieved a good effect. And Abdelrahman Mohamed [15] both used the characterization extracted from the convolutional network to replace the previous absolute position coding representation, thus making the feature length as close as possible to the target output length, thus saving calculation and alleviating the mismatch between the length of the feature sequence and the target sequence. Although the effect is not as good as the RNN model [16], the word error rate is the lowest in the method without language model. Shigeki Karita et al. [17] made a complete comparison between RNN and Transformer in multiple languages, and the performance of Transformer has certain advantages in every task. Yang Wei et al. [18] proposed that the hybrid architecture of CTC+attention has certain advancement in the task of Mandarin recognition with accent. In this paper, a hybrid end-to-end architecture model combining Transformer model and CTC is proposed. By adopting joint training and joint decoding, 2D-Attention mechanism is introduced from the perspectives of time domain and frequency domain, and the training process of Aishell dataset is studied in the shallow encoder-decoder network.

Hybrid CTC/Transformer Model

The overall structure of the hybrid CTC/Transformer model is shown in Figure 1. In the hybrid architecture, chained chronology and multi-head Attention are used in the process of training and grading, and CTC is used to restrain Attention and further improve the recognition rate.

fig 1

Figure 1: An encoder-decoder architecture based on Transformer and CTC.

In end-to-end speech recognition task, the goal is through a network, the input ๐‘ฅ ใ‰ ๐‘ฅ1,โ€ฆ,๐‘ฅ๐‘‡ , calculate all output tags sequence ๐‘ฆ ใ‰ ย ย  ๐‘ฆ1,โ€ฆ,๐‘ฆ๐‘€ย ย ย ย ย ย ย ย ย ย ย ย ย ย  corresponding probability, usually ๐‘€ โ‰ค ๐‘‡, ๐‘ฆ๐‘š โˆˆ ๐ฟ, ๐ฟ is a finite character set, the final output is one of the biggest probability tags sequence, namely

๐‘ฆ* ใ‰  argmax ๐‘ƒi๐‘ฆg๐‘ฅsย ย ย ย ย ย ย ย ย  (1)

๐‘ฆ

Connectionist Temporal Classification

Connectionist Temporal Classification structure as shown in Figure 2, in the training, can produce middle sequence ๐œ‹ ใ‰  ๐œ‹1,โ€ฆ,๐œ‹๐‘‚ , in sequence ๐œ‹ allow duplicate labels, and introduce a blank label ๐‘๐‘™๐‘Ž๐‘›๐‘˜: <โˆ’> have the effect of separation, namely ๐œ‹i โˆˆ ๐ฟ ๐–ด ๐‘๐‘™๐‘Ž๐‘›๐‘˜ . For example ๐‘ฆ ใ‰  wo,ai,ni,Zhong,guo ,

๐œ‹ ใ‰  โˆ’ ,wo, โˆ’ , โˆ’ ,ai,ai, โˆ’ ,ni,ni, โˆ’ ,zhong,guo, โˆ’ ,

fig 2

Figure 2: Connectionist Temporal Classification.

๐‘ฆ’ ใ‰  โˆ’ ,wo, โˆ’ ,ai, โˆ’ ,ni, โˆ’ ,zhong, โˆ’ ,guo, โˆ’ , this is equivalent to construct a many-to-one mapping ๐ต:๐ฟ’ โ†’ ๐ฟโ‰ค๐‘‡ , The ๐ฟโ‰ค๐‘‡ is a possible ๐œ‹ output set in the middle of the sequence, and then get the probability of final output tag:

๐‘ฅย ย  ใ‰  โˆ‘๐œ‹โˆˆ ๐ตโˆ’1i๐‘ฆ’s ๐‘ƒi๐œ‹g๐‘ฅs ๏ผˆ2๏ผ‰

Where, ๐‘† represents a mapping between the input sequence and the corresponding output label; ๐‘ž๐‘ก represents label ๐œ‹๐‘ก at time ๐‘ก corresponding probability. All tags sequence in calculation through all the time, because of the need to ๐‘๐‘‡ iteration, ๐‘ said tag number, the total amount of calculation is too big. HMM algorithm can be used for reference here to improve the calculation speed:

๐‘ƒ๐‘๐‘ก๐‘๐‘ฆ ๐‘ฅ ใ‰  โˆ‘๐‘‡๐‘ฆ’๐‘ขใ‰ 1๐›ผย ย  ๐›ฝ๐‘กi๐‘ขs๐‘ก๐œ‹๐‘กย ย ย ย ย ย ย ย ย ย ย ย ย ย ย ย ย ย ย ย  (3)

Among them, the ๐›ผ๐‘ก ๐‘ข ๐›ฝ๐‘กi๐‘ขs respectively are forward probability and posterior probability of the -th label at the momentย ย ย  to. Finally, from the intermediate sequenceย ย ย ย  to the output sequence, CTC will first recognize the repeated characters between the delimiters and delete them, and then remove the delimiter <โˆ’>.

Transformer Model for 2D-attention

Transformer model is used in this paper, which adopts a multi-layer encoder-decoder model based on multi-head attention. Each layer in the encoder should be composed of a 2-dimensional multi-head attention layer, a fully connected network, and layer normalization and residual connection. Each layer in the decoder is composed of a 2-dimensional multi-head attention layer that screens the information before the current moment, an attention layer that calculates the input of the encoder, a three-layer network that is fully connected, and a layer normalization and residual connection. The multi-head attention mechanism first initializes the three weight matrices.

๐‘„วค๐พวค๐‘‰ by means of linear transformation of the input sequence:

๐‘„ ใ‰  W๐‘„X ; ๐พ ใ‰  W๐พX ; ๐‘‰ ใ‰  W๐‘‰Xย ย ย ย ย ย ย ย ย ย ย ย ย ย ย  (4)

Then the similarity between the matrixย ย ย ย ย ย ย ย ย ย  and K is calculated by dot product:

ฦ’ ๐‘„,๐พ ใ‰  ๐‘„๐พ๐‘‡ (5)

In the process of decoder, requiring only calculated before the current time and time characteristics, the similarity between the information on subsequent moment for shielding, usually under the introduction of a triangle total of 0 and upper triangular total negative infinite matrix, then, the matrix calculated by Equation (5) is transformed into a lower triangular matrix by replacing the negative infinity in the final result with 0. Finally, Softmax function is used to normalize the output results, and weighted average calculation is carried out according to the distribution mechanism of attention:

๐ด๐‘ก๐‘ก๐‘’๐‘›๐‘กi๐‘œ๐‘› ๐‘„,, ใ‰  ๐‘ ๐‘œฦ’๐‘ก๐‘š๐‘Ž๐‘ฅ ฦ’ ๐‘„,๐พย ย ย ย ย  ๐‘‰ย ย ย ย ย ย ย ย ย ย ย ย  (6)

Multi-head attention mechanism actually is to multiple independent attention together, as an integrated effect, on the one hand, can learn more information from various angles, on the one hand, can prevent the fitting, according to the calculation of long attention, if the above results when the quotas for time calculation, then the final result stitching together, converted into a linear output:

๐‘š๐‘ข๐‘™๐‘กi๐ป๐‘’๐‘Ž๐‘‘ ๐‘„,, ใ‰  ๐‘๐‘œ๐‘›๐‘๐‘Ž๐‘ก โ„Ž๐‘’๐‘Ž๐‘‘1,โ€ฆ,โ„Ž๐‘’๐‘Ž๐‘‘๐‘›ย  W๐‘‚ย ย ย ย ย ย ย ย ย ย  (7)

2D โ€“ Attention

The Attention structure in Transformer only models the position correlation in the time domain. However, human beings rely on both time domain and frequency domain changes when listening to speech, so the 2D-Attention structure is applied here, as shown in Figure 3, that is, the position correlation in both time domain and frequency domain is modeled. It helps to enhance the invariance of the model in time domain and frequency domain.

fig 3

Figure 3: The structure of 2D-Attention.

Its calculation formula is as follows:

2๐ท โˆ’ ๐ด๐‘ก๐‘ก๐‘’๐‘›๐‘กi๐‘œ๐‘› ๐ผ ใ‰  W๐‘‚ * ๐‘๐‘œ๐‘›๐‘๐‘Ž๐‘กi๐‘โ„Ž๐‘Ž๐‘›๐‘›๐‘’๐‘™ฦ’,โ€ฆ,โ„Ž๐‘Ž๐‘›๐‘›๐‘’๐‘™ฦ’,

1ย ย ย ย ย ย ย ย ย ย ย ย ย  ๐‘

๐‘โ„Ž๐‘Ž๐‘›๐‘› ,โ€ฆ,๐‘โ„Ž๐‘Ž๐‘›๐‘›๐‘’๐‘™๐‘กsย ย ย ย ย ย ย ย ย ย  (8)

1ย ย ย ย ย ย ย ย ย ย ย ย ย  ๐‘

๐‘คโ„Ž๐‘’๐‘Ÿ๐‘’ ๐‘โ„Ž๐‘Ž๐‘›๐‘›๐‘’๐‘™ฦ’ ใ‰  ๐‘Ž๐‘ก๐‘ก๐‘’๐‘›๐‘กi๐‘œ๐‘›i W๐‘„ * ๐ผ ๐‘‡, W๐พ * ๐ผ ๐‘‡, W๐‘‰ * ๐ผ ๐‘‡s

iย ย ย ย ย ย ย ย ย ย ย ย ย ย  iย ย ย ย ย ย ย ย ย ย ย ย ย ย  iย ย ย ย ย ย ย ย ย ย ย ย ย ย  i

๐‘โ„Ž๐‘Ž๐‘›๐‘›๐‘’๐‘™๐‘ก ใ‰  ๐‘Ž๐‘ก๐‘ก๐‘’๐‘›๐‘กi๐‘œ๐‘›i W๐‘„ *ย  , W๐พ * ๐ผ , W๐‘‰ * ๐ผ s

iย ย ย ย ย ย ย ย ย ย ย ย ย ย  iย ย ย ย ย ย ย ย ย ย ย ย ย ย  iย ย ย ย ย ย ย ย ย ย ย ย ย ย  i

After calculating the 2-dimensional multi-head attention mechanism, a feed-forward neural network is required at each layer, including a fully connected layer and a linear layer. The activation function of the fully connected layer is ReLU:

๐น๐น๐‘ ๐‘ฅ ย ย ใ‰  ๐‘š๐‘Ž๐‘ฅ 0,W1 + ๐‘1 W2 + ๐‘2ย ย ย ย ย ย ย ย ย ย ย ย ย ย  (9)

In order to prevent the gradient from disappearing, the residual connection mechanism should be introduced to transfer the input from the bottom layer directly to the upper layer without passing through the network, so as to slow down the loss of information and improve the training stability:

๐‘ฅ + ๐‘†๐‘ข๐‘๐ต๐‘™๐‘œ๐‘๐‘˜i๐ฟ๐‘Ž๐‘ฆ๐‘’๐‘Ÿ๐‘๐‘œ๐‘Ÿ๐‘ši๐‘ฅssย ย ย ย ย ย ย ย  (10)

To sum up, the Transformer model with 2D-attention is shown in Figure 4. The speech features are first convolved by two operations, which on the one hand can improve the model’s ability to learn time-domain information. On the other hand, the time dimension of the feature can be reduced to close to the quotaslength of the target output, which can save calculation and alleviate the mismatch between the length of the feature sequence and the target sequence.

fig 4

Figure 4: Overall network architecture of Transformer model with 2D-Attention.

The loss function is constructed according to the principle of maximum likelihood estimation:

๐ฟ๐‘Ž๐‘ก๐‘ก ใ‰ โˆ’ ๐‘™๐‘œ๐‘”๐‘ ๐‘ฆ1,2,โ€ฆ,๐‘ฆ๐‘‡’ ๐‘ฅ1,๐‘ฅ2,โ€ฆ,๐‘ฅ๐‘‡

ใ‰  โˆ‘๐‘‡’ย ย ย  ๐‘i๐‘ฆย ย  g,,โ€ฆ,,sย ย ย ย ย ย ย ย ย ย  (11)

๐‘ก’ ใ‰ 1ย ย ย ย ย  ๐‘ก’ย ย ย ย ย ย ย ย ย ย ย ย ย  1ย ย ย ย  2

๐‘ก’ โˆ’1

The final loss function consists of a linear combination of CTC and Transformer’s losses:

๐ฟ ใ‰  ๐œ‡๐ฟ๐ถ๐‘‡๐ถ + ๐›พ๐ฟ๐‘Ž๐‘ก๐‘กย ย ย ย ย ย ย ย ย ย ย  (12)

FBANK Feature Extraction

The process of FBANK feature extraction is shown in Figure 5. In all experiments, the sampling frequency of 1.6KHz and the 40-dimensional FBANK feature vector are adopted for audio data, 25ms for each frame and 10ms for frame shift.

fig 5

Figure 5: Flowchart of FBANK feature extraction.

Speech Feature Enhancement

In computer vision, there is a feature enhancement method called “Cutout” [19]. Inspired by this method, this paper adopts time and frequency shielding mechanism to screen a continuous time step and MEL frequency channel respectively. Through this feature enhancement method, the purpose of overfitting can be avoided. The specific methods are as follows:

๏ผˆ1๏ผ‰ย ย ย  Frequency shielding: Shielding ฦ’ consecutive MEL frequency channels:

[ฦ’0,ฦ’0 + ฦ’s, replace them with 0. Where,ย ย ย ย ย ย ย  is from zero to custom frequency shielding parametersย ย ย ย ย ย ย ย ย ย ย ย ย  randomly chosen from a uniform distribution, and ฦ’0 is selected fromย ย ย ย ย ย ย ย ย ย ย ย ย ย ย  0, โˆ’ ฦ’ randomly, ๐‘ฃ is the number of MEL frequency channel.

๏ผˆ2๏ผ‰ย ย ย  Time shielding: Time step [๐‘ก0,๐‘ก0 + ๐‘กs for shielding, use 0 for replacement, includingย ย ย ย ย ย ย ย ย ย ย ย  from zero to a custom time block parameters randomly chosen from a uniform distribution, ๐‘ก0 from [0,๐‘Ÿ โˆ’ ๐‘กs randomly selected. The speech characteristics of the original spectra and after time and frequency shield the spectrogram characteristic of language contrast as shown in Figure 6, to achieve the purpose of to strengthen characteristics.

fig 6

Figure 6: Feature enhancement contrast chart.

Label Smoothing

The learning direction of neural network is usually to maximize the gap between correct labels and wrong labels. However, when the training data is relatively small, it is difficult for the network to accurately represent all the sample characteristics, which will lead to overfitting. Label smoothing solves this problem by means of regularization. By introducing a noise mechanism, it alleviates the problem that the weight proportion of the real sample label category is too large in the calculation of loss function, and then plays a role in inhibiting overfitting. The true probability distribution after adding label smoothing becomes:

1, iฦ’ii ใ‰  ๐‘ฆs

1 โˆ’ s,ย ย  iฦ’ii ใ‰  ๐‘ฆs

๐‘ƒi ใ‰ 0,ย  iฦ’ii G ๐‘ฆs ๐‘ƒi ใ‰ s

๐พโˆ’1, iฦ’ii G ๐‘ฆs

Where K represents the total number of categories of multiple classifications, and is a small hyperparameter.

Experiment

Experimental Model

The end-to-end model adopted in this paper is a hybrid model based on Linked Temporalism and Transformer based on 2-dimensional multi-head attention. Compare the end-to-end model based on RNN-T and the model based on multiple heads of attention. The experiment was carried out under the Pytorch framework, the GPU RTX 3080.

Data

This article uses Hill Shell’s open source Aishell dataset, which contains about 178 hours of open source data. The dataset contains almost 400 recorded voices from people with different accents from different regions. Recording was done in a relatively quiet indoor environment using three different devices: a high-fidelity microphone (44.1kHz, 16-bit); IOS mobile devices (16kHz, 16-bit); Android mobile device (16kHz, 16-bit) to record, and then by sampling down to 16kHz.

Network Structure and Parameters

The network in this paper uses four layers of multi-head attention, and the input attention dimension of each layer is 256, the input feature dimension of the forward full connection layer is 256, and the hidden feature dimension is 2048. The combined training parameter ฮป is 0.1, the rate of random loss of activated cells is 0.1, and the label smoothing is 0.1. The epoch times are 200.

Evaluation Index

In the evaluation of experimental results, word error rate (WER) was used as the evaluation index. Word error rate is identified primarily for the purpose of make can make between words and real words sequences of the same, the need for specific words, insert, substitute, or delete these insertion (I), substitution (S) or deletion (D) of the total number of words, divided by the real word sequence of all the percentage of the total number of words namely

W๐ธ๐‘… ใ‰  100 ร— ๐ผ + ๐‘† + ๐ท %

๐‘

Experimental Results and Analysis

Table 1 shows the comparison between the 2D-attention model without CTC and the 2D-attention model with CTC. Compared with the ordinary model, the performance of the model with CTC is improved by 6.52%-10.98%, and the word error rate of the end-to-end model with RNN-T is reduced by 4.26%. Performance improved by 37.07%.

Table 1: Comparison of model word error rate.

Model

Test-WER/%

RNN-T

11.50

4Enc+3Dec

9.320

4Enc+4Dec

9.165

4Enc+4Dec+0.1CTC

8.567

6Enc+3Dec

8.130

6Enc+3Dec+0.1CTC

7.237

Figure 7 shows the comparison of the loss functions of the two models (2D-attention model without CTC and 2D-attention model with CTC). Compared with the ordinary model, the loss of the constrained model with CTC can reach a smaller value.

fig 7

Figure 7: Contrast chart of loss changes.

Conclusion

In this paper, we propose a hybrid architecture model of Transformer using CTC and 2-dimensional Multi-head Attention to apply to Mandarin speech recognition. Compared with the traditional speech recognition model, it does not need to separate the acoustic model and the language model to train, only needs to train a single model, from the time domain and frequency domain two perspectives to learn the speech information, can achieve advanced model recognition rate. It is found that compared with the end-to-end model of RNN-T, the performance of Transformer model is better, and the increase in the depth of the encoder can better learn the information contained in the speech, which can significantly improve the performance of the model for Mandarin recognition, while the increase in the depth of the decoder has little effect on the overall performance of speech recognition. At the same time, by introducing a link of sequence alignment is improved, the model makes the model to achieve the best effect, but on some professional vocabulary is not accurate, the subsequent research by increasing solution of language model, at the same time, in view of the very deep network training speed slow problem, to improve and upgrade.

Acknowledgement

This work was supported by the Philosophical and Social Sciences Research Project of Hubei Education Department (19Y049), and the Staring Research Foundation for the Ph.D. of Hubei University of Technology (BSQD 2019054), Hubei Province, China.

References

  1. Yu D, Deng L, YU Kai et al. (2016) Analytical Deep Learning: Practice of Speech Recognition [M]. Beijing: Publishing House of Electronics Industry.
  2. Dahl GE, Yu D, Deng L, Acero A (2012) Context-dependent pre-train deep neural networks for large vocabulary speech recognition. Audio, Speech, and Language Processing. IEEE Transactions 20: 30-42.
  3. Hinton G, Deng L, Yu D, Dahl G, Mohamed A, et al. Deep Neural Networks for Acoustic Modeling in Speech Recognition: The Shar Views of Four Research Groups. Signal Processing Magazine, IEEE 29: 82-97.
  4. Hochreiter S, Schmidhuber J (1997) Long Short-term Neural Computation 9: 1735-1780.
  5. Zhang Y, Chen GG, Yu D, Yao K, Khudanpur S, et al. (2016) Highway Long Short-term Memory RNNS for Distant Speech Recognition[C]. IEEE International Conference on Acoustics, Speech and Signal Processing, March 20-25 Shanghai, China. Piscataway: IEEE Press.
  6. Lecun Y, Bengio Y (1995) Convolutional Networks for Images, Speech and Time-series. Cambridge: MIT Press.
  7. Abdel-Hamid O, Moham AR, Jiang H, Penn G (2012) Applying Convolutional Neural Networks Concepts to Hybrid NN-HMM model for Speech IEEE International Conference on Acoustics, Speech and Signal Processing, March 20, 2012, Kyoto, Japan. Piscataway: IEEE Press: 4277-4280.
  8. Abdel-Hamid O, Moham AR, Jiang H, Deng L, Penn G, et al. (2014) Convolutional Neural Networks for Speech IEEE/ACM Transactions on Audio Speech & Language Processing 22: 1533-1545.
  9. Abdel-Hamid O, Deng L, Yu D (2013) Exploring Convolutional Neural Network Structures and Optimization Techniques for Speech Recognition. Interspeech 58: 1173-1175.
  10. Sainath T N, Moham A R, Kingsbury B, Ramabhadran B (2013) Deep Convolutional Neural Networks for IEEE International Conference on Acoustics, Speech and Signal Processing, May 26-30: Vancouver, BC, Canada. Piscataway: IEEE Press: 8614-8618.
  11. Sainath T N, Vinyals O, Senior A, Sak H (2015) Convolutional, Long Short-term Memory, Fully Connect Deep Neural Networks. IEEE International Conference on Acoustics, Speech and Signal Processing, April 19-24, Brisbane, QLD, Australia. Piscataway: IEEE Press: 4580-4584.
  12. Graves A, Fernรกndez S, Gomez F, Scmidhuber J (2006) Connectionist Temporal Classi๏ฌcation: Labelling Unsegmented Sequence Data with Recurrent Neural Networks. Proceedings of the 23rd international conference on Machine learning 369-376.
  13. Vaswani A, Shazeer N, Pamar N, Uszkoreit J, Jones L, et al. (2017) Attention is All You Need. Advances in Neural Information Processing Systems 6000-6010.
  14. Dong L, Xu S, Xu B (2018) Speech-Transformer: A No-Recurrence Sequence-to-Sequence Model for Speech Recognition. IEEE International Conference on Acoustics, Speech and Signal Processing (ICASSP).
  15. Abdelrahman M, Dmytro O, Luke Z (2019) Transformers with Convolutional Context for ASR. arXiv 1904: 11660.
  16. Kyu J H, Akshay C, Jungsuk K, and Ian L (2017) The Capio 2017 Conversational Speech Recognition System. arXiv 1801: 00059.
  17. Karita S, Wang X, Watanabe S, Yoshimura T, Zhang W, et al. (2019) A Comparative Study on Transformer vs RNN in Speech Applications. IEEE Automatic Speech Recognition and Understanding Workshop (ASRU).
  18. Yang W, Hu Y (2021) End-to-end Accent Putonghua Recognition Based on Hybrid CTC/ Attention Application Research of Computers 38: 755-759.
  19. Pham NQ, Nguyen TS, Niehues J, et al. (2019) Very Deep Self-attention Networks for End-to-end Speech Recognition[EB/OL]. arXiv 13377: 1904.
  20. Ekin D C, Barret Z, Dandelion M, Vijay V, Quoc V (2018) Autoaugment: Learning Augmentation Policies from arXiv 09501: 1805.

Comparative Transcriptomic Analysis for Wheat Etiolated and Green Seedlings during Vernalization

DOI: 10.31038/MGJ.2021422

Abstract

Light can promote the growth and development of wheat seedling during vernalization. However, the mechanism has not been sufficiently explored. In this study, transcriptomic analysis was performed on wheat etiolated seedlings and green seedlings vernalized in dark and light, respectively. Results showed that light could promote photo morphogenesis and photosynthesis of wheat seedlings and increase fresh weigh of seedlings, including root biomass and leaf area. The number of differentially expressed genes (DEGs) between etiolated and green seedlings increased with vernalization time increasing, and the maximum value occurred on vernalization 40 d. GO and KEGG enrichment analysis showed that the main DEGs on vernalization 40 d were significantly different from those on 10, 20 and 30 d in functions. Top GO and KEGG enrichment related to photosynthesis, such as chloroplast, thylakoid, photosynthesis and oxidoreductase activities, were identified on vernalization 40 d. Then a series of candidate genes were identified, 15 of which were confirmed by qRT-PCR. The above findings provide valuable information for understanding the molecular mechanism of light on wheat seedlings during vernalization.

Keywords

Winter wheat, Vernalization, Seedlings, Light, Photosynthesis

Introduction

Wheat (Triticum aestivum L.) is one of the most widely cultivated crops in the world. Its growth and development are determined by complex genetic and environmental factors, in which genes related to vernalization and photoperiod sensitivity play more important roles [1,2].

Winter wheat is sensitive to vernalization and requires a period of continuous cold temperature for its transition from vegetative to reproductive growth [3]. The vernalization response is also integrated with the environmental cue of light. VRN3 is an integrator of the vernalization and photoperiod pathways in temperate cereals, the role of which has been well documented [1,4]. Plants have a sophisticated network to decipher the information of light-temperature integration. The sensation can be defined as a process in which a sensory receptor changes its activity as a result of a stimulus. The photoreceptors phyB and phot have been identified as temperature sensors [5-7].

Light is one of the major environmental factors that regulate seedling growth and development. After seed germination under the soil, dark-grown seedlings usually grow heterotrophically from seed reserves and accumulate protochlorophyllide (Pchlide) via a process referred to as skotomorphogenesis (etiolation; [8]. Upon exposure to light, Pchlide is rapidly converted into chlorophyll to initiate photoautotrophic growth, resulting in large-scale genes expression of photomorphogenesis (greening) [9]. Photomorphogenesis is marked by chlorophyll biosynthesis, differentiation of protoplastids into chloroplasts, initiation of carbon assimilation, elongation and thickening of hypocotyl, and the activation of shoot apical meristem leading to the development [10,11]. There is a comprehensive regulatory network that corresponds to specific morphological aspects in seedling skotomorphogenesis and photomorphogenesis [12-14].

The vernalization in light can promote winter and semi-winter wheat varieties flowering earlier than in dark for [15-17], when plants are stimulated by two external signals, light and low temperature. Some vernalization-responsive genes or proteins have been identified during wheat vernalization by high-throughput transcriptomics and proteomics [18,19]. However, the extent to which genes contribute to wheat seedling development during vernalization remains unclear.

In this study, we conducted RNA-seq analysis to determine the effect of light on transcriptomic changes of wheat seedlings during vernalization. Further, the hypothetical molecular mechanisms of several genes responding to vernalization of wheat in light were discussed.

Materials and Methods

Plant Materials and Vernalization

The uniform seeds of winter wheat Liangxing 99 (vrn-A1/vrn-B1/vrn-D1) were selected and cultivated on plates supplied with moist vermiculite at 25ยฐC in dark, 30 seeds per plate. After 3 d, the developed seedlings were vernalized in dark or in continuous light (25 ยตmol m-2 s-1) in a growth cabinet at 6ยฐC. The light was provided by cool white fluorescent lamp. At each timepoint of vernalization 0, 10, 20, 30 and 40 d, the fresh weight of single plant, fresh weight of seedling leaves, fresh weight of roots, and the longest root length were all measured. Three biological replicates were conducted. SPSS19.0 and Sigmaplot 12.0 were performed to analyze the difference between etiolated and green seedlings.

RNA-seq Sample Preparation and Sequencing

At each investigation timepoint, about 500 mg samples of shoots and leaves per treatment were collected from 5-15 seedlings for total RNA isolation (Figure 1a and 1b). When sampling, the collected leaves and shoots were immediately frozen in liquid nitrogen and then stored at -80ยฐC. Total RNA was extracted with TRIzolโ„ข Reagent (ThermoFisher, USA) following manufacturerโ€™s instructions and confirmed using the 2100 Bioanalyzer (Agilent Technologies). mRNA was purified and then constructed into sequencing library using TruSeq RNA Sample Preparation Kit v2 (#RS-122-2001, Illumina, USA) following manufacturerโ€™s recommendations. The obtained libraries were adjusted and pooled at a concentration of 20 nmol. Sequencing was performed with 300-400 bp, paired-end reads on the NextSeq 500 (Illumina). Each treatment had two biological replicates.

fig 1a

fig 1b

Figure 1: Etiolated and green wheat seedlings used for generating transcriptome, which were vernalized in dark and in light respectively. On each panel, seedlings from left to right were vernalized for 0, 10, 20, 30, and 40 d, respectively.

Data Processing, De-novo Transcriptome Assembly, Differential Expression Gene Analysis

Clean reads with Q-score>20 was further analyzed by removing the adapters and filtering low Q-score reads from raw reads. Reference genome index was constructed using Bowtie2 Software (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) based on the data in Ensembl (http://www.ensembl.org/). The clean reads were aligned to the reference genome by Tophat2 (http://tophat.cbcb.umd.edu/). The original expression level of corresponding gene was considered to be the alignment value (read count) and was analyzed by HTSeq0.6.1p2 (http://wwwhuber.embl.de/users/anders/HTSeq). The read count was normalized with reads per kilobases per million mapped (RPKM), with >1 as gene expressing threshold. Furthermore, the differential expression genes (DEGs) were analyzed by DESeq with |fold change| >2, P-value <0.05, and false discovery rate (FDR) <0.05.

Functional Analysis on DEGs

Gene ontology (GO, http://geneontology.org/) terms with corrected P-value of less than 0.05 were considered to be significantly enriched. KEGG (Kyoto Encyclopedia of Genes and Genomes, http://www.kegg.jp/) enrichment pathways of DEGs were confirmed with P-value<0.05. The DEGs related to photosynthesis and having a minimum 3-fold change were further analyzed.

Evaluation of RNA-Seq by qRT-PCR

To verify the reliability and accuracy of our transcriptomic data, 15 DEGs associated with photosynthesis, signaling interaction, amino acids metabolism, fatty acid metabolism, etc. were selected and evaluated by qRT-PCR. The primers designed with Primer 5.0 Software (PREMIER Biosoft, USA) are detailed in Table S1. Actin was used as an internal control [20]. Using the identical RNA samples for RNA-seq, qRT-PCR was performed on a C1000 Thermal Cycler (CFX96 Real-Time System, Bio-Rad, USA) using a Quant One Step RT-PCR (SYBR Green) Kit (TianGen, China) following manufacturerโ€™s instructions. Three independent biological replicates and three technical replicates per biological replicate were conducted. The PCR efficiency of target and reference genes were determined by generating standard curves and the relative expression values were calculated using the 2โ€“โˆ†โˆ†CT method [21]. With the expression level value on 0 d set as 1, each DEG expression level was recorded and its significance was analyzed by the independent t-test at P-value <0.05. In addition, the relative expression levels of DEGs were analyzed based on RNA-Seq and qRT-PCR, respectively.

Results

Performance of Wheat Seedlings Vernalized in Dark and in Light Conditions

At the beginning, the seedlings for vernalization treatments were exactly the same. On vernalization 10 d, etiolated seedlings, which was vernalized in dark, showed significantly higher fresh weight (including single plant fresh weight, shoot fresh weight and root fresh weight) and root length than green seedlings (Figure 1). However, with the initiation of the photosynthesis and photomorphogenesis, the fresh weight of green seedlings (vernalized in light) were gradually increased and became more than that of etiolated seedlings from vernalization 20 d (Figure 2A). Although green seedlings had less shoot fresh weight compared with etiolated seedlings on vernalization 40 d (Figure 2B), their root fresh weight and length were both significantly more than etiolated seedlings. This indicated that light promoted the growth of wheat seedlings during vernalization (Figure 2C and 2D).

fig 2A,2B

figure 2c, 2d

Figure 2: Performance of wheat seedlings development at five timepoints (0, 10, 20, 30, and 40 d) under dark and light vernalization treatments. A: fresh weight of single plant; B: fresh weight of shoots; C: fresh weight of roots; D: length of the longest root. *, data are mean ยฑ SD of three replicates, P-value <0.05.

Identification of Differential Expressed Genes

The expression level of the DEGs was calculated and normalized to FPKM (fragments per kilobase million), and then DEGs between etiolated and green seedlings were screened with fold change >2 and P-value <0.05. The number of DEGs between etiolated and green seedlings on vernalization 0, 10, 20, 30 and 40 d were 0, 6131, 6971, 7249, and 11807, respectively (Table 1). The maximum was on vernalization 40 d, indicating that more metabolic activities had occurred in green seedlings.

Table 1: Primers for quantitative real-time PCR (qRT-PCR).

Gene ID

Forward primer (5’โˆ’3′)

Reverse primer (5’โˆ’3′)

TRIAE_CS42_4AL_TGACv1_289136_AA0965610

TGCGCGGACAATATATCTCA GTGCAGGATCAAACACATCG
TRIAE_CS42_7BL_TGACv1_579174_AA1904930 AGTGGTATGCCTGCGAGTGC

CTGCTGCTTGTTGATGATTGC

TRIAE_CS42_5DL_TGACv1_432937_AA1395210

CGATGCCAACAGCGACAA CGCCATTGATACCCGTCTT
TRIAE_CS42_3AL_TGACv1_195180_AA0645990 GCTACGCACTTTACGGTATCACA

ACCTTCGCCAACTCCTTCTC

TRIAE_CS42_2DS_TGACv1_179360_AA0606510

CATCATTGGAGGGAGAAACCG CCGCATACTTGGCAAACCTG
TRIAE_CS42_3B_TGACv1_237526_AA0832830 GGAGCTGGTCGAGTTGAAGA

GAACCAAGCCGCTATCTGGT

TRIAE_CS42_1BS_TGACv1_052086_AA0181320

ACCTGGTGTTGCCGATAGAAT CGTTGGGTCGTCAAACTCATAC
TRIAE_CS42_2BL_TGACv1_727308_AA2170970 ACTATCACCCATCGCATCACA

ACACGCCTTCCATTCTCCC

TRIAE_CS42_3AL_TGACv1_195180_AA0645980

CGGGCCTCGCAATTTACA AGTCCTCGCCAACTCGGTCT
TRIAE_CS42_5DL_TGACv1_433817_AA1422930 ACCGCCAAACAAACCCAA

GCAGTCACGAAACCCACCAT

TRIAE_CS42_6AS_TGACv1_486935_AA1566680

ACAGCACCAACTACTGCATCC GGAAGAAGACGACCATCTCCA
TRIAE_CS42_6BS_TGACv1_514208_AA1656980 TCGAGGGGTACTGCATTGTC

CTTGATCTCCTTCACCTTGAGC

TRIAE_CS42_7BS_TGACv1_594457_AA1957650

TACCGACTTCTGCTTCCACTCA ACCCCAGTAATCATCAATACATCC
TRIAE_CS42_5DL_TGACv1_433244_AA1406760 GTTCTACACGCCGGACAAGA

GGTAGCGGTGGATAGGGTTT

TRIAE_CS42_6BL_TGACv1_505061_AA1629060

CGGACTGGTTCAGGAAGGAC CACGTGATGTGAGGGTAGGC
Actin GAAGCTGCAGGTATCCATGAGACC

AGGCAGTGATCTCCTTGCTCATC

Evaluation of RNA-Seq Data by qRT-PCR

To verify the RNA-seq results, 15 DEGs on vernalization 40 d were further analyzed by qRT-PCR. The expression level of every DEG in etiolated seedlings was set as 1. Then their expression level in green seedlings were recorded. qRT-PCR and t-test analysis showed that each of the 15 DEGs showed significantly different expression levels between etiolated and green seedlings, which was consistent with the result from transcriptome sequencing. Also, their expression patterns correlated well (R2 =0.8123) with those obtained from RNA-seq analysis (Figure 3). Therefore, the transcriptome changes obtained by RNA-seq were accurate.

fig 3a, 3b

fig 3c, 3d

Figure 3: Correlation analysis of the 15 differentially expressed genes (DEGs)โ€™ expression levels revealed by RNA-seq and qRT-PCR, respectively. The plots indicate the log2 (Fold change) in RNA-seq and qRT-PCR.

GO Enrichment Analysis of DEGs

The functions of DEGs were annotated by GO enrichment analysis (P-value <0.05) and then they were divided into three terms: biological process, cellular component and molecular function. The topGO enrichment results for DEGs on 10, 20 and 30 d were almost the same. The biological processes of DEGs were mainly involved in cell wall macromolecule catabolic process, aminoglycan catabolic process, chitin catabolic process and oxidation-reduction process (Figures S1-S3); the cellular components were mainly extracellular region, cytoplasmic region, endoplasmic reticulum, photosystem and membrane part (Figures S4-S6); the molecular functions were mainly involved in oxidoreductase activity, chitinase activity, catalytic activity, heme binding, iron ion binding and tetrapyrrole binding (Figures S7-S9).

On vernalization 40 d, a total of 2180 DEGs between etiolated and green wheat seedlings were annotated by GO enrichment analysis (P<0.05). The biological process was mainly involved in photosynthesis, chloroplast organization, cellular ketone biosynthesis process (Figure S10), the cell components were associated with chloroplast, plastid, thylakoid (Figure S11), and the molecular function was associated with chlorophyll binding, fructose-bisphosphatase activity, catalytic activity (Figure S12). This result indicated that the DEGs between etiolated and green seedlings on vernalization 40 d were mainly related to photosynthesis.

KEGG Pathway Analysis of DEGs

KEGG enrichment pathways were selected by DESeq with |fold change| > 2, P-value <0.05, and false discovery rate (FDR) <0.05. The top KEGG pathway of DEGs on vernalization 10, 20 and 30 d were nearly the same. They were involved in amino acids metabolism, fatty acid metabolism, metabolism of cytochrome P450, photosynthesis, environmental adaptation, etc. (Figure 4a-4c). While on vernalization 40 d, the top KEGG enrichment pathways were mainly involved in photosynthesis (photosynthesis-antenna proteins, porphyrin and chlorophyll metabolism, photosynthesis, photosynthetic biological nitrogen fixation, carbon fixation in photosynthetic organisms, etc.), secondary metabolism(including synthesis of flavonoid, anthocyanin, ubiquinone and terpenoid-quinone biosynthesis, indole alkaloid, phenylpropanoid, riboflavin, etc.), nitrogen and carbon metabolism (including vitamins, amino acids, carbon, methane, glyoxylate and dicarboxylate, etc.) and environmental adaptation (circadian rhythm, longevity regulating pathway, and estrogen signal transduction, etc.) (Figure 4d).

DEGs Related to Photosynthesis during Wheat Vernalization

To further understand the effect of light on photosynthesis during vernalization, we focused on the DEGs with a minimum three-fold change in expression between etiolated and green seedlings at V40 d according to KEGG enrichment analysis. Compared with etiolated seedlings, the up-regulated genes in green seedlings were related to chloroplast component, nitrogen and carbon synthesis, while the down-regulated genes were related to catalase, dehydrogenase, ubiquitin, phosphate dikinase and glutamine synthetase.

Discussion

The effect of light on the morphological development of seedlings is achieved through regulating the expression levels of a series of genes [22]. In this study, we used whole-transcriptome sequencing to analyze the seedlings vernalized in dark and in light conditions to identify their molecular changes at different times of vernalization. The results showed that light can regulate a series of genes related to skotomorphogenesis and photomorphogenesis, which is consistent with previous studies [11,12,22,23].

Usually, either triggering photosynthesis or initiating flowering is the acting mode of light on plants. The former is the energy source of plant, while the latter is the developmental key from vegetative growth to reproductive development [24,25]. Interestingly, the results in this paper indicated that light can significantly increase the length and fresh weight of roots but inhibit the growth of above ground part of seedlings. Previously, it has been proved that light influence root development and plasticity through complex signaling pathways [26]. Generally, the roots of dark-grown seedlings are much shorter and have a much thinner diameter than those of light-grown seedlings [27,28]. In speed breeding, green plant vernalization can promote winter wheat flowering earlier in the subsequent development process [16,17]. Therefore, during vernalization process, supplementation of light may be conducive to promoting the morphological development of roots and leaves, as well as indirectly promoting later flowering development.

In our study, GO and KEGG enrichment analysis shows that the significantly DEGs between seedlings vernalized in dark and in light are mainly involved in photosynthesis with the elongation of wheat vernalization. Chlorophyll is essential for harvesting light energy during photosynthesis. It is proved that the complex integration of intracellular chloroplast retrograde redox signaling combined with intercellular, and vascular-mediated signaling pathways during vernalization process enhance both photosynthetic capacity and plant biomass production in cold-grown winter cereals.

In this experiment, the level of chloroplast, photosystem II 10 kDa polypeptide, fructose 1,6-bisphosphatase, pyruvate, phosphate dikinase (PPDK) was higher in green seedlings than in etiolated seedlings. Chlorophyll is essential for light harvesting and energy transduction during photosynthesis. Leaf color results from the processes of chlorophylls accumulation in leaf, which is related to chloroplast development and division, biosynthesis [29]. Photosystem II (PSII) is a multisubunit protein-pigment complex embedded in the thylakoid membrane that harnesses light energy to split water into oxygen, protons, and electrons [30]. Fructose 1,6-bisphosphatase is required for optimum regulation of photosynthetic carbon metabolism. Fructose 6-phosphate (F6P) is the branch point for metabolites leaving the Calvin cycle and moving into starch biosynthesis through the conversion into glucose 6-phosphate (G6P) [31]. Pyruvate, phosphate dikinase (PPDK), a key role in the C4 photosynthetic pathway, proposed first functionally seated in C3 plants as an ancillary glycolytic enzyme [32]. In intact spinach chloroplasts, light-induced dephosphorylation of C(3) PPDK was shown to be dependent on photosystem II activity but independent of electron transfer from photosystem I [33-35].

Therefore, the above up-regulation genes associated with photosynthesis and Calvin cycle improves the biomass of seedlings under light. Meanwhile, the developing seedlings under dark could reduce their light-harvesting capacity and components of photosynthetic apparatus.

Conclusions

The analysis of DEGs between seedlings vernalized in dark and in light indicates that light influences plant growth and development by triggering photosynthesis and feeding plants energy. Thus, the supplementation of light during wheat vernalization can directly improve the biomass of seedlings, as well as indirectly promote the later reproductive development.

References

  1. Distelfeld A, Li C, Dubcovsky J (2009) Regulation of flowering in temperate cereals. Current Opinion in Plant Biology 12: 178-184. [crossref]
  2. Dennis E S, Peacock W J (2009) Vernalization in cereals. Journal of Biology 8: 57.
  3. Trevaskis B (2010) The central role of the VERNALIZATION1 gene in the vernalization response of cereals. Function Plant Biology 37: 479-487.
  4. Yan L, Fu D, Li C, Blechl A, Tranquilli G, et al. (2006) The wheat and barley vernalization gene VRN3 is an orthologue of FT. PNAS 103: 19581-19586. [crossref]
  5. Jung JH, Domijan M, Klose C, Biswas S, Ezer D, et al. (2016) Phytochromes function as thermosensors in Arabidopsis. Science 354: 886-889. [crossref]
  6. Legris M, Klose C, Burgie ES, Costigliolo RC, Neme M, et al. (2016) Phytochrome B integrates light and temperature signals in Arabidopsis. Science 354: 897-900. [crossref]
  7. Fujii Y, Tanaka H, Konno N, Ogasawara Y, Hamashima N, et al. (2017) Phytotropin perceives temperature based on the lifetime of its photoactivated state. Proceedings of the National Academy Sciences of the United States of America 114: 9206-9211.
  8. Von Arnim A, Deng XW (1996) Light control of seedling development. Ann Rev Plant Physiol Plant Mol Biol 47: 215-243. [crossref]
  9. Shi H, Lyu MH, Luo YW, Liu SC, Li Y, et al. (2018) Genome-wide regulation of light-controlled seedling morphogenesis by three families of transcription factors. PNAS 115: 6482-6487. [crossref]
  10. Seo HS, Yang JY, Ishikawa M, Bolle C, Ballesteros ML, et al. (2003) LAF1 ubiquitination by COP1 controls photomorphogenesis and is stimulated by SPA1. Nature 423: 995-999.
  11. Fox SE, Geniza M, Hanumappa M, Naithani S, Sullivan C, et al. (2014) Denovo transcriptome assembly and analyses of gene expression during photomorphogenesis in diploid wheat Triticum monococcum. PLoS One 9: 96855. [crossref]
  12. Xiong B, Ye S, Qiu X, Liao L, Sun GC, et al. (2017) Transcriptome analyses of two citrus cultivars (Shiranuhi and Huangguogan) in seedling etiolation. Scientific Reports 7: 46245.
  13. Xie F, Yuan JL, Li YX, Wang CJ, Tang HY, et al. (2018) Transcriptome analysis reveals candidate genes associated with leaf etiolation of a cytoplasmic male sterility line in Chinese cabbage (Brassica Rapa L. ssp. Pekinensis). Int J Mol Sci 19: 922. [crossref]
  14. Armarego-Marriott T, Sandoval-Ibaรฑez O, Kowalewska ล (2020) Beyond the darkness: recent lessons from etiolation and de-etiolation studies. J Exp Bot 71: 1215-1225.
  15. Mukade K, Kamio M, Hosoda K (1975) Development of new procedures for accelerating generation advancement in breeding rust resistant wheat. Bulletin of the Tohoku National Agricultural Experiment Station 1: 1-5.
  16. Lu WZ, Zhou YK, Zou ML, Feng XT (1982) A preliminary study on the green-vernalization in wheat. Scientia Agricultura Sinica 2: 20-23.
  17. Wang HB, Xie XL, Sun GZ, Zhang YQ, Zhao H, et al. (2000) Fast breeding technique to achieve many generations a year in plants. Patent CN 1262031A, Hebei, China.
  18. Greenup AG, Sasani S, Oliver SN, Walford SA, Millar AA, et al. (2011) Transcriptome analysis of the vernalization response in barley (Hordeum vulgare) seedlings. PLoS ONE 6: 17900. [crossref]
  19. Feng YL, Kong BB, Zhang J, Chen XN, Yuan JL, et al. (2018) Proteomic analysis of vernalization responsive proteins in winter wheat Jing841. Protein and Peptide Letters 25: 260-274. [crossref]
  20. Simonetti E, Veronico P, Melillo MT, Delibes ร, Andrรฉs M F, et al. (2009) Analysis of class III peroxidase genes expressed in roots of resistant and susceptible wheat lines infected by Heteroderaavenae. Molecular Plant-Microbe Interactions 22: 1081-1092. [crossref]
  21. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2โˆ’ฮ”ฮ”CT method. Methods 25: 402-408. [crossref]
  22. Montgomery BL (2016) Spatiotemporal phytochrome signaling during photomorphogenesis: from physiology to molecular mechanisms and back. Frontiers in Plant Science 7: 480. [crossref]
  23. Kami C, Lorrain S, Hornitschek P, Fankhauser C (2010) Light-regulated plant growth and development. Current Topics in Development Biology 91: 29-66. [crossref]
  24. Cerdan PD, Chory J (2003) Regulation of flowering time by light quality. Nature 423: 881-885. [crossref]
  25. Renger T, Mรผh F (2013) Understanding photosynthetic light-harvesting: A bottom up theoretical approach. Physical Chemistry Chemical Physics 15: 3348-3371.
  26. Gelderen K V, Kang C, Pierik R (2018) Light signaling, root development and plasticity. Plant Physiology 176: 1049-1060. [crossref]
  27. Laxmi A, Pan JW, Morsy M, Chen RJ (2008) Light plays an essential role in intracellular distribution of auxin efflux carrier PIN2 in Arabidopsis thaliana. PLoS One 3: 1510. [crossref]
  28. Dyachok J, Zhu L, Liao FQ, He J, Huq E, et al. (2011) SCAR mediates light-induced root elongation in Arabidopsis through photoreceptors and proteasomes. The Plant Cell 23: 3610-3626. [crossref]
  29. Yang Y, Chen X, Xu B, Li Y, Ma Y, et al. (2015) Phenotype and transcriptome analysis reveal chloroplast development and pigment biosynthesis together in๏ฌ‚uenced the leaf color formation in mutants of Anthurium andraeanum โ€˜Sonateโ€™. Front Plant Sci 6: 139. [crossref]
  30. Crepin A, Santabarbara S, Caffarri S (2016) Biochemical and spectroscopic characterization of highly stable photosystem II supercomplexes from arabidopsis. J Biol Chem 291: 19157-19171. [crossref]
  31. Tamoi M, Nagaoka M, Miyagawa Y, Shigeoka S (2006) Contribution of fructose-1,6-bisphosphatase and sedoheptulose-1,7-bisphosphatase to the photosynthetic rate and carbon flow in the Calvin cycle in transgenic plants. Plant & Cell Physiology 47: 380-390. [crossref]
  32. Chastain CJ, Failing CJ,ย  Manandhar L, Zimmerman MA, Lakner MM, et al. (2011) Functional evolution of C4 pyruvate, orthophosphate dikinase. J Exp Bot 62: 3083-3091.
  33. Chastain CJ, Fries JP, Vogel JA, Randklev CL, Vossen AP, et al. (2002) Pyruvate, orthophosphate dikinase in leaves and chloroplasts of C (3) plants undergoes light-/dark-induced reversible phosphorylation. Plant Physiol 128: 1368-1378. [crossref]
  34. Dalal VK, Tripathy BC (2018) Water-stress induced downsizing of light-harvesting antenna complex protects developing rice seedlings from photo-oxidative damage. Sci Rep 8: 5955. [crossref]
  35. Kohzuma K, Froehlich JE, Davis GA, Temple JA, Minhas D, et al. (2017) The role of light-dark regulation of the chloroplast ATP Synthase. Frontiers in Plant Science 8: 1248. [crossref]

How the Medical Profession Contributes to COVID-19 Vaccine Hesitancy

DOI: 10.31038/JNNC.2021434

 

Hopefully the pandemic will be over within another year. In the meantime, the medical profession and public health officials continue to denigrate and sanction โ€˜anti-maskersโ€™ and โ€˜anti-vaxxersโ€™, as discussed in previous papers [1-6]. This behavior inflames the people characterized as anti-vaxxers and anti-maskers, increases polarization, and breeds distrust in the medical profession. These effects of the denigration and sanctions can do nothing but increase vaccine hesitancy. The medical profession should stop putting all blame for vaccine hesitancy on a misinformed public, and instead should examine its own contributions to vaccine hesitancy. I am double vaccinated. There are a number of topics that illustrate the unhelpful attitudes and unscientific statements of doctors and public health officials during the pandemic. These are reviewed below.

Ivermectin

Ivermectin for COVID-19 has been attacked aggressively in the courts, the media and the medical literature as being ineffective. It has been referred to as a โ€˜horse worm drugโ€™ even though it has long been approved by the FDA for use in humans. The main study cited to justify the banning of ivermectin from clinical practice randomized 238 patients with mild-moderate COVID-19 to ivermectin and 238 to placebo [7]. The authors reported adverse events occurring in 77% of participants receiving ivermectin and 81.3% of those on placebo, indicating both that ivermectin is safe compared to placebo, and a high nocebo effect rate in both groups. Both groups received a 5-day course of ivermectin or placebo. There was an escalation of care to a higher level in 4 participants receiving ivermectin and 6 receiving placebo. The median time to resolution of symptoms was 10 days on ivermectin and 12 on placebo. There were no statistically significant differences between groups on any outcome measures. However, ivermectin resulted in a 17% reduction in time to symptom resolution. The authors cited four randomized controlled trials of ivermectin that had not yet been published, all with positive results, including one with substantial differences between ivermectin and placebo on a range of clinical measures [8].

Although the reduction in time to symptom resolution was not statistically significant in the JAMA study [7], a 17% reduction in duration of symptoms would result in a very large reduction in personal suffering across a large sample. If ivermectin also reduced hospitalizations and deaths by 17% in a future randomized controlled trial, that would be very helpful. Normally, in medicine, a study like this would not be used to support a ban on using the medication in hospitals or clinics. Rather, there would be a call for further research, and prescribing the medication would be regarded as a legitimate off-label use of the medication in clinical settings, given that it is generic, cheap and safe, especially if there were no more effective medications available. Although there is a posture of science and protecting patients in mainstream medicine, the behavior of the medical profession with regards to ivermectin has been starkly different from standard practice. In standard practice, the existence of a trial showing a reduction in time to symptoms resolution of 17%, plus a set of unpublished trials showing a positive effect, would never result in the aggressive dismissal of that medication. This is disturbing because such deviations from standard medicine could happen regarding any disease or treatment in the future, if politics over-ride standard practice. It doesnโ€™t matter if ivermectin proves not to be useful in properly designed future trials. The problem is the unscientific hostility towards a cheap, generic, safe and potentially useful medication. The standard mantra – โ€œthere is no evidence that ivermectin worksโ€ – is not scientifically true. That is an attitude, not a scientific statement.

Lockdown Mandates

The justifications for lockdowns at the height of a pandemic are clear and valid, but there has been an over-use and over-reaction in government lockdown mandates. For example, as a former resident of the Northwest Territories in Canada, I was interested to read that the level of lockdown there has just been increased by the top public health physician. Why? In a population of 44,991 people [9], throughout the entire pandemic there have been 2 COVID-19 deaths [10] and 918 confirmed infections as of September 24, 2021. This is a death rate of 2/44,991 = 0.00004 and an infection rate of 0.02. As percentages, these are an infection rate of 2% and a death rate of 0.004%. How do those numbers justify an increased lockdown? Similarly, in the Canadian province of New Brunswick, levels of lockdown have been increased recently [11]. The province of 781,315 people has recorded 49 deaths (49/781,315 = 0.0006, or a death rate of 0.06%): the increased lockdown level is justified by one additional recent death. These lockdowns in response to those levels of threat do not make sense. This does not mean that one should be โ€˜anti-lockdownโ€™, but it calls into question the judgment of public health officials. Excessive lockdowns will breed distrust in the medical profession and public health officials and fuel vaccine hesitancy.

The Wuhan Lab Leak Theory

It is possible that the COVID-19 pandemic started with a lab leak at the Wuhan Institute of Virology [6]. It is also possible that it did not. A serious problem in the medical profession has been the vitriol and condemnation directed at anyone who supported the Wuhan lab leak theory, at least for the first year of the pandemic. This vitriol was justified by a letter in The Lancet on March 7, 2020 [12] in which the authors stated that: โ€œWe stand together to strongly condemn conspiracy theories suggesting that COVID-19 does not have a natural origin.ย . . Conspiracy theories do nothing but create fear, rumours, and prejudice that jeopardise our global collaboration in the fight against this virus. We support the call from the Director-General of WHO to promote scientific evidence and unity over misinformation and conjecture.โ€

The problem with this letter [12] was the major conflicts of interest that the authors did not disclose [13]. Rather, they represented themselves as objective scientists. Of the 27 authors of the letter, 26 had direct connections with the Wuhan Institute of Virology. For example: Peter Daszak and five other authors were affiliated with EcoHealth Alliance, which funded gain of function research on coronaviruses at the Wuhan Institute of Virology; three authors were affiliated with Britainโ€™s Welcome Trust which funded research at the Wuhan Institute of Virology; and five were coauthors of Dr. Ralph Baric, who is an author on papers from the Wuhan Institute of Virology. The Lancet letter was designed to shut down any suggestion that the pandemic could have started with a leak from the Wuhan Institute of Virology. This is not objective science. It is using an appearance of science for politics and self-protection. This kind of posturing by leading figures in virology and public health carries the risk of blowback once it is exposed for what it is, which in turn can do nothing but undermine confidence in public health and the medical profession.

Treating the Unvaccinated as Untouchables

There is nothing wrong with trying to motivate people to get vaccinated for COVID-19. It seems clear that the risk for severe illness, hospitalization and death all drop substantially with vaccination. However, it is less clear that vaccination by itself reduces the rate of viral transmission in public when social distancing is in place. We know that vaccinated individuals can have break-through infections. Regardless, unvaccinated people are now being shunned, denigrated, and financially punished: they are becoming untouchables. For example, the New York Metropolitan Transportation Authority recently changed its policy to continue a $500,000.00 death benefit for the families of employees who die of COVID-19, but canceled the benefit for families of unvaccinated employees [14]. Similarly, Southwest Airlines withheld an award of an extra 16 hours of pay from unvaccinated workers while also cutting sick pay for unvaccinated workers [15]. In New York, the Governor is considering bringing in out-of-state health care workers and declaring a state of emergency due to the number of health care workers refusing to get vaccinated [16]; recent legislation prevents them from coming to work. Bringing in out-of-state health care workers would compound staff shortages and burnout in other states. In addition, the New York state labor department issued guidance that people who lose their jobs due to vaccine refusal will not be eligible for unemployment benefits. These government actions will cause โ€˜anti-vaxxersโ€™ to regard their own actions as morally justified civil unrest, which will in turn reinforce their behavior and increase the dividedness and hostility in the United States.

The motive of encouraging people to get vaccinated is fine, but these methods are not. They create two classes of citizens and punish one class financially for exercising what, up till now, has been a right. Why do we not punish smokers and the morbidly obese for occupying hospital beds and imposing costs on society, including increased insurance premiums? Such punishment would be widely regarded as a human rights violation. The difference is that unvaccinated people increase the risk of infection for others. However, smoking can increase the health risks for other people due to second-hand exposure, yet no one punishes smokers or their families financially. No-smoking areas are designed to protect people, not to punish smokers, who experience only a minor inconvenience from not being able to smoke indoors. The problem here is not the fact that vaccination rates are lower than is desirable. The problem is that public health and medicine are becoming tools for punitive social control. If unchecked, this could escalate in a dangerous direction. The medical profession has been contributing to the creation of a class of untouchables, the unvaccinated. This has been done through nasty condemnation, threats to withhold medical services, and government financial penalties. More people have died from drug overdoses in the twenty-first century than from coronaviruses. There are negative attitudes towards โ€˜addictsโ€™ in both the general public and the medical profession, but the pandemic ramps such attitudes up because of the fear it generates. These negative attitudes push people away from the medical profession. There are two forces at work: doctors driving anti-maskers and anti-vaxxers further away into isolation and extremism, and extremists pulling them in that direction. Rather than attacking the attractive force, the medical profession should reduce the repulsive force.

Face Masks

There are no randomized controlled trials that demonstrate a reduction in viral transmission in public from wearing face masks, and there are multiple trials demonstrating no effect [2,4]. A year and a half into the pandemic, the negative trials are still not referenced by doctors, the CDC, public health officials and governments who strongly recommend or mandate face masks. This is an example of politics over-riding science. Two recent studies reported by the CDC [16,17] that are characterized as providing strong evidence in favor of face masks do not actually do so. In one study [16], the authors surveyed 3142 counties but included only 16.5% of them in their final analysis, which rules out the results being representative or valid. In the other study [17], the authors surveyed 999 schools and divided them into 210 schools that adopted masking early in the study time period, 309 that adopted masks late, and 480 that never adopted a mask mandate. They reported the percentage of schools experiencing a COVID-19 outbreak during the study period, but they never defined an โ€˜outbreakโ€™. Whether an outbreak could be one case, or required some minimum number of cases was not stated. Thus, the no-mask schools, in principle, could have had fewer total cases than the masked schools because they had a smaller number of cases per outbreak. The authors concluded that, โ€œthis was an ecologic study, and causation cannot be inferred.โ€ In their text [17,18], the percentages of schools with outbreaks were: early mask 8.4%; late mask 32.5%; and no mask 59.2%. However, in their table the percentages were: early mask 8.0%; late mask 20.0%; and no mask 24%. The numbers in the table suggest that there was no difference between late masking and no masks โ€“ the lower percentage in the early mask schools could have been due to the virus not being as widespread in the early part of the study period, rather than a mask effect. Why doctors, public health authorities and governments recommend mask mandates remains a mystery. Mask mandates are a risky strategy because once the public catches on that face masks do not work for reducing viral transmission in public, the medical profession could experience blowback and there could be increased vaccine hesitancy.

Concluding Thoughts

The problem outlined here is not with ivermectin, face masks, the Wuhan lab leak, or mandates as such. The problem is the misinformation being provided by doctors, governments and public health authorities during the pandemic. This misinformation can do nothing but increase distrust in the medical profession and vaccine hesitancy. Physicians have contributed to the creation of a social class of untouchables โ€“ the โ€˜anti-maskersโ€™ and โ€˜anti-vaxxersโ€™ โ€“ who are denigrated and accused of spreading misinformation, which they often do. But the social ostracism of this class, which includes a significant number of medical workers, is compounding the problem of vaccine hesitancy, not solving it. The medical profession should take a look at its own misinformation rather than attacking members of the public. Attacking is different from educating. This does not mean that vaccine hesitancy is entirely the medical professionโ€™s fault โ€“ but medicine should examine its own role in vaccine hesitancy and any unintended consequences of its attitudes, behavior and recommendations.

References

  1. Ross CA (2020) Thoughts on COVID-19. Journal of Neurology and Neurocritical Care 3: 1-3.
  2. Ross CA (2020) Facemasks are not effective for preventing transmission of the coronavirus. Journal of Neurology and Neurocritical Care 3: 1-2.
  3. Ross CA (2020) Differences in evaluation of hydroxychloroquine and face masks for SARS-CoV-2. Journal of Neurology and Neurocritical Care 3: 1-3.
  4. Ross CA (2020) How misinformation that facemasks are effective for reducing COVID-19 is transmitted. Journal of Neurology Neurocritical Care 3: 1-2.
  5. Ross CA (2021) mRNA vaccines for SARS-CoV-2 are โ€œ95% effectiveโ€: What does that mean? Journal of Neurology and Neurocritical Care 3: 1-1.
  6. Ross CA (2021) Misinformation concerning face masks and the Wuhan lab leak. Journal of Neurology and Neurocritical Care 4: 1-3.
  7. Lopez-Medina E, Lopez P, Hurtado IC, Dรกvalos DM, Ramirez O, et al. (2021) Effect of ivermectin on time to resolution of symptoms among adults with mild COVID-19. A randomized controlled trial. JAMA 325: 1426-1435. [crossref]
  8. Elgazzar A, Hany B, Youssef SA, Hafez M, Moussa H, et al. (2020) Efficacy and safety of ivermectin for treatment and prophylaxis of COVID-19 pandemic. Research Square. DOI: https://doi.org/10.21203/rs.3.rs-100956/v2
  9. NWT Bureau of Statistics (2021) Northwest Territories population, April 2021. https://www.statsnwt.ca/population/population-estimates/PopEst_Apr2021.pdf.
  10. Government of the Northwest Territories (2021) COVID-19 in NWT. https://www.gov.nt.ca/cov.
  11. Author (2021) N.B. COVID-19 roundup: Record 76 new cases and another death reported as new measures take place. CBC. https://ca.yahoo.com/news/n-b-covid-19-roundup-135336077.html.
  12. Calisher C, Carroll D, Colwell R, Corley RB, Daszak P, et al (2020). Statement in support of the scientists, public health officials, and medical professionals of China combatting COVID-19. Lancet 395: E42-43. [crossref]
  13. Knapton S (2021) Itโ€™s already โ€˜too lateโ€™, but that doesnโ€™t make it pointless. Daily Skeptic, https://niqnaq.wordpress.com/2021/09/14/its-already-too-late-but-that-doesnt-make-it-pointless/.
  14. Martinez J (2021) MTS yanks $500K COVID death benefit from unvaccinated transit workers. The City, https://www.thecity.nyc/2021/9/12/22667777/no-covid-death-benefit-for-unvaccinated-mta-bus-subway-workers.
  15. Dean G (2021) Southwest Airlines is giving fully vaccinated staff 16 hours extra pay โ€“ and cutting sick pay for unvaccinated workers who catch COVID-19. Business Insider, https://www.businessinsider.com/southwest-airlines-covid-vaccine-incentive-pay-unvaccinated-staff-mandate-2021-9.
  16. Hayes C, Bacon J (2021) Yens of thousands of New York health care workers could lose jobs as soon as today over vaccine: covid-19 updates. https://ca.yahoo.com/news/massachusetts-troopers-quit-over-vaccine-080021866.html.
  17. Budzyn SE, Panaggio MJ, Parks SE, Papazian M, Magid J, et al. (2021) Pediatric COVID- 19 cases in counties with and without school mask requirements โ€“ United States, July 1-September 4, 2021. Morbidity and Mortality Weekly Report Report (MMWR) 70: 1377-1378.
  18. Jehn M, McCullough JM, Dale AP, Gue M, Eller B, et al. (2021) Association between K-12 school mask policies and school-associated COVID-19 outbreaks โ€“ Maricopa and Pima counties, Arizona, July-August 2021. Morbidity and Mortality Weekly Report (MMWR) 70: 1372-1373.

Study of Epidemiology and Human Papilloma Virus Prevalence in Oral Cavity Cancers

DOI: 10.31038/MGJ.2021421

Abstract

Oral cavity cancers (OCC) are the most common malignancies in the subcategory of head and neck cancers, and represent the 6th most common cancer in the world. These cancers have become more frequent in individuals without a history of alcohol-tobacco abuse, which are the major risk factors. Other factors have been suggested, such as viral infections, but especially genetic alterations. This work establishes the epidemiological profile and researches the presence of viral DNA in OCCs. The epidemiology was highlighted with 105 patients using the Epi Info software. HPV DNA was sought in 50 samples of diseased tissue and blood by attempting to amplify its L1 region by PCR. At the epidemiological level, the results show a mean age of 53.2 years, a sex ratio of 0.8 and a low consumption of tobacco (16.2%) and alcohol (4.8%). HPV was not detected in any of the samples. Thus, the epidemiological profile of OCCs in Senegal is different from that in other countries, and HPV is not associated with its occurrence.

Keywords

Cancer, Oral cavity, HPV, Epidemiology

Introduction

The epidemiology of cancers of the oral cavity is part of the more general framework of cancers of the upper aerodigestive tract (UADT) [1]. They account for approximately 25 to 30% of UADT cancers [2]. In general, they appear from the sixth decade of life [3] with alcohol and tobacco being identified as the main risk factors. They are ranked as the 6th most common cancer worldwide, and 3rd in developing countries [4]. Globally, they had 354,864 new cases in 2018, or 2% of all cancers, and approximately 177,384 cases of deaths, or 1.9% of cancer deaths [5]. Men account for 69.4% of cases, with a higher cumulative risk of dying before age 75. Age-standardized incidence rates are lower in West Africa, with little difference between men and women at 1.2 and 1.1 cases per 100,000 persons/year, respectively [5,6]. The five most affected countries are India (77,003 cases), the United States (26,064 cases), China (21,413 cases), Pakistan (12,761 cases), and Bangladesh (10,550 cases) [7]. Reports have shown that the global incidence is higher in more developed regions, but mortality is higher in less developed regions, which reflects social inequality [8].

According to GLOBOCAN [9], it is the 16th most common cancer in Senegal, with 130 new cases during the last 5 years and 111 deaths. The average age is about 52 years and the female sex predominates, with the majority being non-alcoholic-tobacco users [10,11]. In Africa in general and in Senegal in particular, data on cancers of the oral cavity are scarce and besides that the epidemiology differs from other countries.

Based on epidemiologic and clinicopathologic evidence, it has been proposed that Human Papillomavirus (HPV) infection is linked to the development of oral cancer [12]. HPV is one of the most common sexually transmitted infections and belongs to a large family of viruses, the papovaviridae. They are small (about 55 nm in diameter) and epitheliotropic. Their genome is composed of 7,200 to 8,000 base pairs with molecular weights of 5.2 x 106 daltons. They have a double-stranded circular DNA with a capsule of 72 capsomers of icosahedral structures, without a lipoprotein envelope [13]. Numerous papillomaviruses are known, with over 150 types; however, not all genotypes are considered carcinogenic [14]. Based on their potential oncogenic activity, HPV subtypes have been divided into high-risk (HPV-HR) and low-risk (HPV-LR) viruses. HPV-HR are associated with cancer development and are called viral โ€œoncogenesโ€ [15]. The prevalence of HPV in normal oral mucosa (latent infection) and its relationship to oral cancer have generated conflicting opinions. Most of the published studies have included several head and neck subsites, which have prevented specific analysis of HPV involvement in oral carcinogenesis [16]. In addition, the frequency of HPV infection in oral cavity cancer shows a lot of variation between studies around the world [17]. To support the implication of HPV in oral tumors, few studies have been conducted to determine the frequency of HPV DNA exclusively in squamous cell carcinoma of the oral cavity, particularly in Senegal. Hence, this study aims to update the epidemiological profile of oral cavity cancers and to detect the presence of HPV in them.

Methodology

This study was approved by the Research Ethics Committee of Cheikh Anta Diop University (Reference: Protocol 0272/2018/CER/UCAD). One hundred and five (105) patients diagnosed with OCCs between March 2017 and October 2020, at the Department of Stomatology and Maxillofacial Surgery of the Hospital Center University Aristide Le Dantec in Dakar were the subject of this study. Demographic, clinico-pathological, and etiological data were collected from the patients’ clinical records and then entered with Microsoft Excel 2016 spreadsheet for statistical analyzes, thereby allowing the description of the epidemiological profile of OCC in Senegal. Epi Info software version 7.2.4.0 enabled these analyses to be carried out by providing, among other things, the number of patients, the frequency, and the 95% confidence interval for each parameter studied. For statistical tests, a p value <0.05 is considered significant.

DNA extraction was performed from blood and tissue using the Zymo research kit and the Purelink viral RNA/DNA kit according to the manufacturer’s conditions. In order to test for the presence of viral DNA in the OCCs, the L1 gene was amplified using the primer pair (MY09/11). PCR was performed using 25 ยตl of master mix, 1 ยตl of forward primer, 1 ยตl of reverse primer, 1 ยตl of MgCl2, 20 ยตl of ultrapure water and 2 ยตl of DNA. The following conditions were used: 94ยฐC for 5 min; 35 cycles (94ยฐC for 30 s, 55ยฐC for 30 s, 72ยฐC for 1 min); 72ยฐC for 15 min. A positive control (PC) for cervical cancer was used.

Results

Characteristics of the Population

The clinical parameters of the one hundred and five (105) patients enrolled in this study are listed in Table 1. More than half (55.4%) come from the different regions of Senegal. Age at diagnosis ranged from 22 to 90 years, with 38.1% of patients aged between 50 and 64 years old. There was a slight predominance of women, with a sex ratio of 0.8, and they were older than men (55.7 years vs. 49.9 years) with a non-significant p-value of 0.12. Histologically, 93.3% of cases are squamous cell carcinomas, and are generally well differentiated (64.8% of cases). Different structures of the mouth are affected: the gum (30.5% of cases), the tongue (17.1%) and the inner face of the cheek (15.2%) are the most affected. Among the patients whose tumor size was reported, the majority (23 cases) were larger than 4 cm in size. The presence of lymphadenopathy (s) was noted in 21.9% of patients, and 48.6% were at an advanced stage (stage III or IV). The rate of alcohol and tobacco use was low, with only 16.2% of smokers and 4.8% of alcohol users. Note that 21.9% of cases have poor oral hygiene.

Table 1: Epidemiological and clinical characteristics of patients.

Characteristics

Minimum Maximum

Average

Age (year)

Overall age

22 90 53.2
Men 22 78

49.9

Women

25 90

55.7

Number

Frequency (%)

CI (95%)

Gender

Male

46 43.8 34.1-53.8
Female 59 56.2

46.2-65.9

Sex ratio

0.8

Age groups

Under 35 years

19 18.1 11.3-26.8
35 years – 49 years 19 18.1

11.3-26.8

50 years – 64 years

40 38.1 28.8-48.1
65 years and older 27 25.7

17.7-35.2

Origin

Dakar

41 39 29.7-49.1
Other regions 55 52.4

42.4-62.2

Neighboring countries

9 8.6

4-15.6

Histopathology

Squamous cell carcinoma

98 93.3 86.7-97.3
Adenoid carcinoma 1 1

0-5.2

Verrucous carcinoma

1 1 0-5.2
Sarcoma 4 3.8

1-9.5

Lymphoma

1 1

0-5.2

Differentiation

Good

68 64.8 54.8-73.8
Average 15 14.3

8.2-22.5

Weak

8 7.6 3.3-14.5
NP 14 13.3

7.5-21.4

Tumor site

Gum

32 30.5 21.9-40.2
Tongue 18 17.1

10.5-25.7

Cheek

16 15.2 9-23.6
Lip 8 7.6

3.3-14.5

Palate

6 5.7 2.1-12
Floor 2 1.9

0.2-6.7

Facial mass

9 8.6 4-15.6
Mixed 14 13.3

7.5-21.4

Tumor size (cm)

T โ‰ค 2

3 2.9 0.6-8.1
2 ห‚ T โ‰ค 4 18 17.1

10.5-25.7

T หƒ 4

23 21.9 14.4-31
Large extension 18 17.1

10.5-25.7

NA

43 41

31.5-51

Lymphadenopathy

Positive

23 21.9 14.4-31
Negative 82 78.1

69-85.6

 

Stage

Early (stage I + stage II)

13 12.4 6.8-20.2
Advanced (stage III + stage IV) 51 48.6

38.7-58.5

NA

41 39

29.7-49.1

Common risk factors

Tobacco

17 16.2 9.7-24.7
Alcohol 5 4.8

1.6-10.8

No Alcohol-smoking

66 62.8 52.9-72.1
NA 17 16.2

9.7-24.7

Oral hygiene

Poor

23 21.9 14.4-31
Good/NA 82 78.1

69-85.6

TOTAL

105

100

Table 2 shows the distribution of age groups in relation to gender. For all age groups, the incidence is higher in women except those under 35 years of age.

Table 2: Distribution of the different age groups in relation to gender.

Men Women
Age groups Number Frequency (%) Number Frequency (%)

Total

Under 35 years

13

68.4 6 31.6

19

35-49 years

8

42.1 11 57.9

19

50-64 years

14

35 26 65

40

65 years and older

11

40.8 16 59.2

27

P-value=0.11

Amplification Reactions of the HPV L1 Region

The result of this PCR for 10 cancerous tissue and one positif control is shown in figure 1. The latter shows the absence of viral DNA for our samples, except for the positive control which shows a band, of about 450 bp. The result is the same for all samples (tissue and blood).

fig 1

Figure 1: Electrophoretic migration profile of PCR products from the L1 region.
MW:molecular weight; TC = Cancerous tissue PC: positive control; TN: negative control.

Discussion

One of the first activities of this study was to collect tumor samples as well as clinical data from patients with OCC at the Department of Stomatology and Maxillofacial Surgery of the Hospital Center University Aristide Le Dantec. Of the 105 cases, 59 (56.2%) were women as opposed to 46 (43.8%) men. This shows that in Senegal, there is a slight predominance of women in the incidence of OCC, with a sex ratio of 0.8. This sex ratio is identical to that found in Senegal by Dieng et al. [11], and not far from the result of Millogo et al. [18] in Burkina with a sex ratio of 0.85. In this study, the hypothesis is supported according to which the aesthetic concern would lead women of our societies to consult more often than men as soon as a significant anomaly is noticed in the oro-maxillo-facial sphere. However, oral cancer is considered worldwide as a male pathology and especially in the most affected countries like India [7]. Indeed, in India, a study by Singh et al. [19] identified 84.8% of men as opposed to 15.2% of women.

Cancer is a disease whose risk increases with age. In Europe and America, the average age of patients with OCC is estimated to be around 60 years old [3]. In Africa, the average age range is from 47.8 years in Cรดte d’Ivoire to 49.15 years in Burkina [18]. In our study, the modal class 50 – 64 years represents 38.1% of the cases (40 patients), with a mean age of 53.2 years for the entire study population. This result is close to those found by Tourรฉ et al. [10] and Dieng et al. [11] with 52.6 and 52.9 years of mean age, respectively. This age difference with developed countries could be explained by the difference in standard of living and therefore easier access to medical care, disfavoring for example poor oral hygiene for these populations [2,18]. Indeed, poor oral hygiene is thought to play a direct role in the occurrence of OCCs [20] and it may play a non-negligible role in Senegal [21]. It was often poor in the study by Tourรฉ et al. [10], and for the study of Millogo et al. [18], all patients experienced poor oral hygiene. In our case, these represent 21.9% of the study population, but with missing data.

Despite the fact that older people are more exposed, our results show that young people are also not spared from the disease, especially among men. In fact, in our results, 38 patients were not yet in their fifties and 19 of them were under 35 years of age, 68.42% of whom were men. Tourรฉ et al. [10] had observed in their cohort that 38% of patients were under 50 years of age. In many countries of the world, there has been an alarming increase in the incidence of oral cancer, especially among young men [3]. This could be explained by earlier exposure to common risk factors such as tobacco use [7] as is the case in India or Pakistan. In these regions, the average age of patients is between 41 and 50 years and one-third of the population aged 15 years uses tobacco in any form [22]. However, the consumption of these substances (tobacco and alcohol) is not common among patients with OCC in Senegal [10,11]. Our results confirm this with only 17 smokers (16.2% of cases), and 5 alcoholics (4.8%). The low alcohol consumption is explained by the fact that 95% of the population is Muslim [21].

The fact that 93.3% of the cases in our study were squamous cell carcinomas is not surprising, since it is well known that they account for more than 90% of all oral cancers [23]. Most studies have confirmed the predominance of squamous cell carcinomas, but with different frequencies. They were the predominant histological type for: Singh et al. [19] for all cases (100%), Dieng et al. [11] with 98% of cases, and 55.9% for Millogo et al. [18]. The latter support the hypothesis that the predominance of squamous epithelial tissue in the mucosa is the cause of this high frequency of squamous cell carcinomas.

The tongue is one of the most common sites in OCCs with 40% of cases [8] especially in Western countries due to excessive smoking and alcohol consumption [22]. In 2005, according to Tourรฉ et al. [10], the mandible (24.8%), tongue (21.9%) and maxilla (15.2%) represented the majority sites. The gum (30.5% of cases), tongue (17.1%) and inner face of the cheek (15.2%) are the most affected sites in our study. The fact that the maxillary and mandibular gingiva are grouped together may have caused this high rate for the gingiva. This distribution of tumor sites could be explained by poor dental hygiene: either non-healing after dental extraction, creating an open wound in the gum area; or decayed teeth, traumatizing the cheek or tongue, especially for the latter.

More than half of OCCs were diagnosed at stage III or IV [20]. This was the case in Senegal based on previous studies with an average of 86% of cases diagnosed at advanced stages [10,11]. For 48.6% of the cases in our study, the disease was at an advanced stage (stage III or IV), with the presence of lymphadenopathy in 23 cases (21.9%). However, a lot of data are missing to make an estimate of the stage of the disease in our study population. The diagnosis at an advanced stage shows an irregularity or a late consultation of our population at the level of oral care structures, which can be explained by a weakness at the financial level or by the ignorance for example of the early signs of the disease. Other authors such as Millogo et al. [18] point to the omnipresence of traditional medicine as perhaps the first resort in our societies

This epidemiological study has certain limitations, such as the large number of unspecified data for a few parameters, or the failure to take into account other parameters such as occupation. The existence of a register or database of oral cancers, which compiles data from all hospital services receiving patients with this pathology, would allow us to know a little more about this disease and its incidence in Senegal.

Searching for HPV DNA was also one of the objectives of the study. It was done by gene amplification of its L1 region on 50 extracts of cancerous tissue and 50 extracts of blood, and none revealed the presence of this virus. This suggests that there is no significant association between OCCs and HPV infection. Ndiaye et al. [21] found only 3.4% HPV-positive cases in a study conducted in Senegal on head and neck cancers (HNC). This study, in addition to our own, shows that the prevalence of HPV in HNCs in Senegal is low. This is more or less the same observation that has been made in some African countries. For example, HPV was found in 6.3% of HNC cases in a study in South Africa; [24] 0.74% in Central Africa for Kofi et al. [25]; and like our case, it could not be detected in studies in Mozambique [26] and Nigeria [27]. These results are different from what has been reported in other parts of the world. In a systematic review by Kreimer et al. [28] compiling data from 60 studies, the overall HPV positivity was 25.9%; and North American countries were more representative than Europe or Asia. Ndiaye et al. [29] reported a positivity of 31.5% when compiling 148 studies. Ndiaye et al. [21] argue that there are ethnic disparities regarding the prevalence of the virus in these cancers, with less of it being found to affect the black race. Indeed, studies in the US have shown this to be the case [30,31]. For example Settle et al. [30] found 34% positivity in whites as opposed to 4% in blacks. This racial difference would be explained by risky sexual practices, especially oral sex, which is believed to be more prevalent among whites; but also by genetic differences between the two groups, impacting host immunity or viral integration [27]. It also appears that smoking, besides being an independent risk factor in developed countries, makes infections more likely to persist, thus increasing the risk of developing HPV-related diseases [32].

Furthermore, it is recognized that the highest prevalences of HPV infection in HNCs are found in the oropharynx (45.8%) including the tonsils (53.9%), compared to 24.2% for the oral cavity [29]. Thus, the oral cavity is not the preferred site for HPV in HNCs.

Conclusion

As a result of the heterogeneous etiology and lack of definite prognosis of oral cavity cancers, this study aimed to contribute to a better understanding of the epidemiological and molecular profile of patients with OCC in Senegal. An epidemiological profile different from that of Western or Asian countries was found. Indeed, it is that of a relatively young individual, often of a female gender, nonalcoholic-smoker. Added to this is the absence of HPV in patients with OCC in Senegal. Thus, the risk factors are not yet clearly identified, and this opens the way to the search for other factors such as those related to the environment, lifestyle or diet, but especially genetic events.

References

  1. Barthรฉlรฉmy I, Sannajust JP, Revol P, Mondiรฉ JM (2005) Cancers of the oral cavity. Preamble, epidemiology, clinical study. EMC-Oral Maxillofac Surg 1.
  2. Bissa H, Darre T, Pegbessou PE, Amana P, et al. (2014) Histo-epidemiological profile of cancers of the oral cavity, about 66 cases observed in Togo. Rev Col Odonto-Stomatol Afr Chir Maxillo-fac 21: 5-9.
  3. Adeola DS, Obiadazie AC (2006) Oro-facial carcinoma in Kaduna. Niger J Surg Res 8: 144-147.
  4. Patil NN, Wadhwan V, Chaudhary M, Nayyar AS (2016) KAI-1 and P53 Expression in oral squamous cell carcinomas: Markers of significance in future diagnostics and possibly therapeutics. J Oral Maxillofac Pathol 20: 384-389.
  5. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, et al. (2018) Global Cancer Statistics 2018: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA: Cancer J Clin 68: 394-424. [crossref]
  6. Ferlay J, Colombet M, Soerjomataram I, Mathers C, Parkin DM, et al. (2019) Estimating the global cancer incidence and mortality in 2018: GLOBOCAN sources and methods. Int J Cancer 144: 1941-1953. [crossref]
  7. Salehiniya H, Raei M (2020) Oral cavity and lip cancer in the world: An epidemiological review.ย Biomed Res Ther 7: 3898-3905.
  8. Rivera C (2015) Essentials of oral cancer. Int J Clin Exp Pathol 8: 11884-11894. [crossref]
  9. Global Cancer Observatory (GLOBOCAN)/2018 data. Cancer Today. International Agency for Research on Cancer/OMS.
  10. Toure S, Sonko L, Diallo BK, Diop R, et al. (2005) Epidemiological profile of oral cavity cancers in Senegal. J Stomatol Maxillofac Surg 106: 68-71.
  11. Dieng MM, Dem A, Gaye PM, Diouf D, Toure S, et al. (2012) Cancers of the oral cavity: about 145 cases at the Joliot-Curie Institute in Dakar. Cancer/Radiother 16: 547.
  12. Betiol J, Villa LL, Sichero L (2013) Impact of HPV infection on the development of head and neck cancer Brazilian. J Med Biol Res 46: 217-226.
  13. Alvarenga GC, Sรก EMM, Passos MRL, Pinheiro VMS (2000) Human papillomavirus and cervical carcinogenesis. J Bras Doenรงas Sex Transm 12: 28-38.
  14. Wagner S, Sharma SJ, Wuerdemann N, Knuth J, Reder H, et al. (2017) Human papillomavirus-related head and neck cancer. Oncol Res Treat 40: 334-340. [crossref]
  15. Lafaurie GI, Perdomo SJ, Buenahora MR, Amaya S (2018) Human papilloma virus: An etiological and prognostic factor for oral cancer? J Investig Clin Dent 9: 11.
  16. Paolini F, Rizzo C, Sperduti I, Pichi B, Mafera B, et al. (2013) Both mucosal and cutaneous papillomaviruses are in the oral cavity but only alpha genus seems to be associated with cancer. J Clin Virol 56: 72-76. [crossref]
  17. Abreu PMD, Gregรณrio AC, Pedro Leite Azevedo PL, Valle IBd, Oleiviera KGD, et al. (2018) Frequency of HPV in oral cavity squamous cell carcinoma. BMC cancer 18: 324. [crossref]
  18. Millogo M, Bambara TA, Ouรฉdraogo RWL, Konsem T, et al. (2019) Oro-maxillo-facial cancers at the Yalgado Ouรฉdraogo University Hospital Center in Ouagadougou. Rev Col Odonto-Stomatol Afr Chir Maxillo-fac 26: 42-47.
  19. Singh RD, Patel KR, Patel PS (2016) P53 mutation spectrum and its role in prognosis of oral cancer patients: a study from Gujarat, west India. Mutat Res 783: 15-26. [crossref]
  20. Bambara AT, Millogo M, Konsem T, Bambara HA, et al. (2015) Cancers of the oral cavity: predominantly female disease in Ouagadougou. Med Buccale Chir Buccale 21: 61-66.
  21. Ndiaye C, Alemany L, Diop Y, Ndiaye N, Dieme MJ, et al. (2013) The role of human papillomavirus in head and neck cancer in Senegal. Infect Agents Cance 8: 14.
  22. Anwar N, Pervez S, Chundriger Q, Awan S, Moatter T, et al. (2020) Oral cancer: Clinicopathological features and associated risk factors in a high-risk population presenting to a major tertiary care center in Pakistan. PLoS One 15: 0236359.
  23. Bagan J, Sarrion G, Jimenez Y (2010) Oral Cancer: Clinical Features. Oral Oncol 46: 414 โ€‘ 417.
  24. Sekee TR, Burt FJ, Goedhals D, Goedhals J, Munsamy Y, et al. (2018) Human papillomavirus in head and neck squamous cell carcinomas in a South African cohort. Papillomavirus Res 6: 58-62. [crossref]
  25. Kofi B, Mossoro-Kpinde CD, Mboumba Bouassa RSM, Pรฉrรฉ H, Robin L, et al. (2019) Infrequent detection of human papillomavirus infection in head and neck cancers in the Central African Republic: A retrospective study. Infect Agents Cancer 14: 9. [crossref]
  26. Blumberg J, Monjane L, Prasad M, Carrilho C, Judson BL, et al. (2015) Investigation of the presence of HPV related oropharyngeal and oral tongue squamous cell carcinoma in Mozambique. Cancer Epidemiol 39: 1000-1005. [crossref]
  27. Oga EA, Schumaker LM, Alabi BS, Obaseki D, Umana A, et al. (2016) Paucity of HPV-related head and neck cancers (HNC) in Nigeria. PLoS One 11: e0152828. [crossref]
  28. Kreimer AR, Clifford GM, Boyle P, Franceschi S (2005) Human papillomavirus types in head and neck squamous cell carcinomas worldwide: a systematic review. Cancer Epidemiol Biomarkers Prev 14: 467-475. [crossref]
  29. Ndiaye C, Mena M, Alemany L, Arbyn M, Castellsague S, et al. (2014) HPV DNA, E6/E7 mRNA, and P16INK4a detection in head and neck cancers: a systematic review and meta-analysis. Lancet Oncol 15: 1319-1331. [crossref]
  30. Settle K, Posner MR, Schumaker LM, Tan M, Suntharalingam M, et al. (2009) Racial survival disparity in head and neck cancer results from low prevalence of human papillomavirus infection in black oropharyngeal cancer patients. Cancer Prev Res. (Phila) 2: 776-781. [crossref]
  31. Weinberger PM, Merkley MA, Khichi SS, Lee JL, Psyrri A, et al. (2010) Human papillomavirus-active head and neck cancer and ethnic health disparities. Laryngoscope 120: 1531-1537. [crossref]
  32. Hรผbbers CU, Akgรผl B (2015) HPV and Cancer of the Oral Cavity. Virulence 6: 244-248. [crossref]

Methods and Technologies of Internal Speech Recognition by Non-Invasive Neurointerfaces

DOI: 10.31038/ASMHS.2021531

Abstract

The brain coordinates the reproduction and understanding of internal speech. The processes of thinking are given in the form of internal speech. The perception of internal speech involves the primary and secondary crust centers of analyzers, which record the corresponding waves, signals and rhythms and qualify them as language. This is achieved in two ways: either use functional neuroimaging and other additional research methods that allow localizing the structures currently functioning, or select patients with damage to certain areas and conduct a detailed neurocognitive study in comparison with healthy people from the control group, determining which functions in this lesion fall out. The principal issue of internal speech research is languages. A more complex question is the study of the connection of thinking, memory with internal speech. Now, especially when neurologists take into account the plasticity of the brain, functional relationships, general principles, pathways of excitation are of greater interest. Technologists of non-invasive neurointerfaces use methods and technologies to localize structures that control the understanding and reproduction of internal speech, the communication between them, the stages of speech signal processing and the role of each structure at these stages. The introduction to the study highlights approaches and methods for identifying various functional speech aspects. The mental lexicon section discloses the semantic component and the syntactic component, as well as the perceived and reproducible forms of words of internal speech. The section holographic human consciousness describes aspects of storing life information. The hologram of consciousness is the main form of storage of information about human life. In the section, holographic fixation of internal speech presents functional magnetic resonance tomography focused on BOLD effect detection, which is today the optimal tool for mapping neuronal activity, more precisely, the functional state of neural networks – the basis for visualizing our holographic images in real time. Using nanoresonators with Fourier transducers, the brain activity of a human internal speech holographic image can fix mental noninvasive neurointerface in language form by mental lexicon.

Keywords

Mental lexicon, Holographic consciousness, Neurointerface, Functional magnetic resonance tomography

Introduction

Internal speech is related to thinking: the modern position of cognitive science is such that without internal speech, thinking, primarily abstract-logical, is impossible [1]. If the studies are supplemented by functional neuroimaging, they are also of particular interest as a reflection of neuronal plasticity processes [2,3]. Electrophysiological studies use the method of induced potentials. The area in which the identified potential is generated can be determined based on its severity in different leads:

– The potential N400, negative, reaches the maximum amplitude 400 ms after the presentation of the corresponding stimulus, most pronounced in the centroparietal zone, reflects the processes of semantic analysis, that is, awareness of meaning.

– LAN potential (front left negative wave), resembling a N400 in delay, but most pronounced in leads from the left frontal departments, responds to the use of parts of speech that do not fit into the syntactic structure of this sentence (for example, “soft toy” instead of “soft toy”) [4];

The most famous electrostimulation studies belong to Canadian neurosurgeon Wilder Penfield. He described the results of his work in the monograph “Language and Brain Mechanisms,” still relevant for neurologists and cognitive specialists [5].

This can also include studies using deep brain stimulation [6] and transcranial magnetic stimulation, which began to be carried out relatively recently.

Functional neuroimaging methods are currently leading methods in the study of the neurophysiology of internal speech. Let us judge which structures are functioning at the moment:

– Functional magnetic resonance imaging (fMRI) and positron emission imaging of certain brain regions;

-diffuse-tensor MRI allows visualization of conducting brain pathways connecting these areas; magnetoencephalography (MEG) makes it possible to measure and graphically represent magnetic fields that are formed due to electrical activity of the brain.

The structure responsible for understanding speech is the Wernicke zone, the posterior part of the upper temporal gyrus. This area is adjacent to the auditory cortex, specialized in speech perception and contains sensory images of words and their combinations characteristic of the native language. The model also claims that sensory images do not carry semantic content – this aspect of speech cannot be specifically localized in the brain, but, nevertheless, in the process of signal processing, there should be an appeal to the “repository” of concepts – the semantic units of our speech. There are links between the Wernicke zones and the “repository” of concepts [7].

The “double flow” model was open to visual perception. After treatment in the visual cortex of the occipital lobe, the signal follows ventral and dorsal flows. Ventral goes to the temporal lobe and is necessary for identifying the object (answers the question “what?”), And dorsal goes to the parietal lobe and is designed to recognize the spatial characteristics of the object, its position and possible ways of interacting with it (answers the question “how?”)

Primary processing regarding the phonological composition and frequency-time characteristics occurs in the back of the upper temporal gyrus and the areas surrounding the upper temporal furrow, for the most part this is the Wernicke zone. The ventral flow is directed to the front and middle parts of the temporal lobe, it participates in the actual recognition and lexical analysis of speech (understanding its meaning, correlating with concepts stored in memory). Dorsal participates in sensorimotor integration, that is, correlation with motor images of words, and includes two separate paths: both pass through the temporal-parietal region, then the first is directed to the lower frontal gyrus, and the second to the prefrontal cortex. Presumably, one of them participates in the perception of internal speech, that is, controls the construction of segment sequences and provides more complex skills.

Hicoca-Popel claims that the perception of internal speech, through the functioning of the ventral flow, occurs bilaterally, and the intermediate center of dorsal flows working exclusively in the dominant hemisphere is placed in the temporal-parietal zone along the sylvium groove, at the junction of the temporal platform and operculum parietale [8].

In ventral flow, which is mainly involved in semantic and syntactic processing, excitation also moves along several paths. The lower frontal-occipital tuft connects the lower frontal cortex and dorsolateral frontal cortex with the posterior part of the temporal and parietal lobe. It passes through the anterior leg of the external capsule into the temporal lobe and gives branches to the middle and lower temporal gyrus, as well as the occipital lobe [9]. When stimulating this beam, semantic paraphasias are observed in the experiment [10]. Dorsal flow, in turn, is related to extended syntax and is evolutionarily later and perfect [11].

In speech perception activation of interested structures is asymmetric [12-14]. Differences were found in the activation of parietal and frontal centers: it is shown that the latter are characterized by a large degree of lateralization, this indirectly indicates in favor of the possible bilateral activity of the ventral flow, which, however, as the level of treatment increases to a more complex one, is “interrupted” by a more lateralized dorsal [15]. There is mutual activation between symmetric speech structures of different hemispheres. What is observed in healthy patients as equilibrium [16]. The left hemisphere is logical, and the right emotional and creative, for example, specifically-shaped thinking, tasks related to the manipulation of objects, images. The left hemisphere is more specialized for recognition of time characteristics, and the right hemisphere is more specialized for recognition of frequency characteristics [17]. This distribution was shown for the anterior part of the upper temporal gyrus, where information is processed immediately after the primary auditory cortex [18]. This is confirmed, for example, by recent tractographic analysis [19].

Scientists at Carnegie Mellon University and Minnesota State University have been able to create a virtually non-invasive technology that will allow paralyzed patients to control mechanisms and robotic prostheses with the power of thought. To do this, they had to overcome the main problem of non-invasive neurointerface: unlike the implant, it receives a much more noisy signal, and therefore, the accuracy and speed of control decreases. With the help of the latest sensors and machine learning, the researchers were able to get signals from the depths of the brain, clear them of interference and for the first time achieved high quality control by a robotic hand, On the BrainBit neurointerface tape there are 4 dry EEG electrodes, reference and common electrodes, as well as a miniature electronic module. This allows you to register a professional electroencephalogram with the best quality among the neurointerfaces available on the market. The device amplifies and digitizes the received signal and transmits it using the Bluetooth protocol to a computer, smartphone or tablet. Unlike analogues, the position of the electrodes on the tape BrainBit corresponds to the international arrangement of electrodes 10-20. Electrodes provide direct contact in areas of temporal lobe T3 and T4, as well as in occipital region O1 and O2. According to advanced international studies, these zones are optimal for recording the level of four main types of brain waves. BrainBit records electrical activity in the form of “raw data” of EEG, which are presented as levels of the four main rhythms of the brain. All brain activity data obtained can be sent to the cloud for analysis and processing by machine learning methods. The BrainBit SDK contains a set of tools for developers that allow you to obtain both raw EEG data and calculated values โ€‹ โ€‹ of brain activity rhythms. The SDK facilitates complex data processing and analysis by simplifying application development. The application can display the state of the user’s brain based on color indicators. These graphical indicators complement qualitative and quantitative indicators demonstrating the current state of the brain.

Mental Lexicon

A mental lexicon is a collection of word information that includes the actual meaning of a word, a semantic component, a syntactic component, as well as perceived and reproducible forms of words [2]. In the mental vocabulary, the brain finds and learns what we ourselves are going to fish. We are trying to look where our thought processes take place into the mental lexicon [2].

Firstly, morphemes are considered its smallest unit – minimal meaning-containing units [2]. These are roots, suffixes, prefixes. At the same time, the mental lexicon can have several levels, and on one of them the minimum unit will be a word.

Secondly, it is not a list that is sequentially viewed, but a network where each unit is associated with many others. The essence of such an organization is that words related in meaning are often used in the same mental situation, and if internal talk is about one, it would be wise to keep the rest carefully. The more often words are used together, the stronger the connection between them, the more inclined it is to move along this connection during the associative process. Freud’s invented free association method confirms this.

Thirdly, the mental lexicon does not have one organizing principle, but several at once. The master is semantic, that is, the connections are made by value. The importance of this principle is proved by the semantic priming effect, in the Russian-language literature the term “precedence effect” is used. Two words are used in the experiment: “previous” is always a real word, and “target” can also be a real word, a pseudo word that is built in accordance with phonetic principles, but is not in the language, or simply an unreadable set of letters. The subject needs to click the button to decide whether the target word shown to him is real, a pseudo word (similar in structure to the present, but non-existent, as a “deep cusd”) or an impracticable set of letters – the so-called situation of the “lexical solution.” If the “previous” word is associated in meaning with the “target,” the subject performs the task many times faster: the memory has already passed to the “catalog section” in which this word was in one semantic bundle, it remained only to find it [2].

The mental lexicon is central to the organization of internal speech. Each word is present in the “library” in all grammatical forms, for example, the times of verbs or the genera of adjectives. Due to this, semantic and syntactic information is extracted simultaneously at the lexical access stage. When calling the word “red,” the names of other colors, red objects and others associated with it are activated in the semantic network (Figure 1).

fig 1

Figure 1: Semantic principle of mental lexicon organization

Lexical selection is the stage at which, among all activated word forms, the most suitable is selected. Lexical integration is the combination of all words into larger structures: phrases, sentences, up to whole internally connected texts. The preparation of texts includes macro and micro planning.

Communication is one way to influence the environment. Therefore, communication, like any action, is subordinate to the motivational sphere and can be aimed at meeting the need or eliminating inconvenience. On the example of instructive expressions, this can be seen especially clearly, but our other statements seem to have the same goal, because there are simply no other sources of motivation. Thus, any statement should be formulated based on the result that we want to receive – this aspect of the preparation of the message is called macro-planning. When microplanning, the question is developed how the information should be presented: which group of words to use, in which relationships to put them. After preparing the message at the output, a “concept” is obtained, the general meaning of the whole sentence.

The mental lexicon is a specific concept, and it manages smaller, more formal units than the “repository of concepts.” Similarly, only people can be the bearers of ideas that really understand them, and although all the rich variety of expressions for these ideas are stored in the library, only books that read them “animate.”

The formulation of expressions is to give the sentence a specific form, grammatical and phonetic, ready for pronunciation. The concept obtained in the first stage interacts already with the mental lexicon; the first thing to decide on is part of internal speech. At the output, we get the corresponding lemma – the initial form of the word. Many different word forms are associated with lemma. According to the grammatical principle, lexical selection of word forms occurs. Then there is morphemic analysis. The resulting word will need to be called, preparation for which is phonological analysis: analysis of the number of syllables and the position of emphasis in the word.

There is little neuroscience evidence that addresses the issue of mental lexicon; they make it possible to create a holistic picture. Elizabeth Warrington and colleagues investigated the problem of selective items belonging to only one category, and how they can relate to semantic memory. It turned out that semantic memory is divided into “categories.” In our mental vocabulary, not every word is connected with each so that you can come to it in a different way; some kind of division, dispersal is still there. Warrington identified such groups: living beings, which are mainly associated with terms describing their appearance and other properties perceived by the senses; and artificial objects – they are usually described by the function that they perform.

Human Holographic Consciousness

Human consciousness, like a hologram, contains everything that is in a multiple updating system from finite shifting professions. The hologram of consciousness is the basis for storing information about human life.

The principle of the hologram “everything in each part” allows a fundamentally new approach to the issue of organization and order. The hologram shows that some things cannot be investigated by an analytical method: to dissect an object and study its constituent parts. If we dissect anything on the hologram, then we will not get the parts of which it consists, but we will get the same, but with less accuracy.

Our ability to quickly find the right information from the vast volume of our memory is provided by a brain that works on the principle of a hologram. Indeed, one of the most amazing properties of human thinking is that each piece of information is instantly and mutually associated with the other – another property inherent in the hologram.

Memory location is not the only neurophysiological mystery that has become more solvable in the light of Pribram’s holographic brain model. The other is how the brain is able to translate such an avalanche of frequencies that it perceives by various sensory organs (frequencies of light, sound frequencies, and so on) into our specific idea of โ€‹ โ€‹ the world. Frequency coding and decoding is exactly what the hologram handles best. Just as the hologram serves as a kind of lens, a transmitting device capable of turning a apparently meaningless frequency interfere into a coherent image, so the brain, according to Pribram, contains such a lens and uses the principles of holography to convert frequencies from the senses into the inner world of our perceptions.

Pribram’s idea that our brains construct solid reality by relying on input frequencies has also received experimental confirmation. It has been found that any of our sensory organs has a large frequency range of susceptibility. In particular, the researchers found that our visual organs are susceptible to sound frequencies, that our sense of smell depends somewhat on what is now called osmotic frequencies, and that even our body cells are sensitive to a wide frequency range. This is the work of the holographic part of our consciousness, which converts separate chaotic frequencies into continuous perception.

The holographic model also shows that consciousness is not a function of the brain, but, on the contrary, the neural networks of the brain are controlled by consciousness, which, therefore, does not die if the brain dies. In holographic reality, thought is as real as consciousness.

A single universe has projections in the form of a discretely updated frequency wave-like structure – a hologram, the main content of which is consciousness, which is its copy. Discrete update of the projection by consciousness means the appearance of durations, which qualifies as time.

A single universe enters time by means of its own projection in the form of a frequency wave-like structure – a hologram, forming its own time and at the same time – the general of the entire structure of being due to its holographic essence (the whole and part coincide). The active living in the holographic projection of the Single, copying fragments of the passive from the Single, are combined with them individually and as a whole, and through themselves form the current time, space and things in motion.

The conversion of wave matter (packets of information) from the holographic projection of the Single in any living creature, including in man, into his environment, is carried out by him no longer in the form of images, but in the form of material objects of different “density” and various forms using the corresponding matrices (shaping abilities), creating both the living being itself and its environment within the framework of common time, which is the consequence of the action of a single consciousness in a combined set of living beings.

The formation of objects of various forms in accordance with the mass-forming abilities (matrices) of a living creature is carried out according to the type of work of a 3D printer.

The holographic image of living beings allows them to be separate, living each time their own life, having their own time, their own being, and at the same time in their totality – to be a single being that is eternal both in its singularity and in each of its own.

As for the genome, it is based on a program copied by consciousness in a projection from the Unified to the molecular chains of the genome in accordance with its existing shaping abilities for each particular case.

Information is an activity property. Without material objects-carriers, including consciousness itself, information does not exist. For each person, discrete information is automatically (with the help of a single consciousness) converted into things, images, meanings, feelings, which are also quite material components of each individual consciousness, entailing subsequent actions of the carrier of consciousness.

Living beings are involved in the information process. With the help of information processing centers, they are able to immerse themselves in a liveable environment. All human achievements are connected in the form of acquired experience in this field, existing knowledge and skills with certain target focus.

In the form of light and sound, a person can approach the harmony of his own wave basis of the ideal, which is actually the holographic basis of a person.

The time of any living creature, in particular, and man, is an information process during which material objects are recognized by consciousness by scanning the environment by the processing centers at its disposal. The informational (impulse) nature of time formation is asymmetric (one-sided), differing from the usual real or energy interactions of objects in that a living being unilaterally scans the surrounding one, sequentially copying the data recognized and grouped by it. This high-frequency complete update of one position of the next, etc., in particular, does not allow you to go back or run forward due to the asymmetry (one-sidedness) and completeness of the update of each position. Therefore, it seems to each person that time flows in one direction: from the past to the future through the present. Due to the complete updating of one position by another, that is, irretrievably and infinitely, in the form of an infinitely updated ultra-high-frequency wave-shaped holographic projection in the form of intermittent moments-durations (pulses of information).

For humans, information passes every moment to brain neurons from different human sensory organs in the form of sequences of nerve impulses; each of the pulses contains corresponding information. Immediately after the pulse generation, the nerve fiber is in the so-called refractor state, and cannot be reactivated for 1-2 milliseconds, that is, the nerve fiber is able to conduct nerve pulses with a frequency not higher than 500 hertz. The duration of the pulse itself passing through the nerve fiber is a fraction of a millisecond in each moment.

A pause between nerve impulses containing information means that they do not go continuously. However, this pause is below the threshold of perception by her consciousness and therefore does not fall into it. In particular, the moving picture for human consciousness is provided by an interval between the run-through successive frames of about 0.04 seconds, which is said threshold. Its duration, as you can see, is more than an order of magnitude longer than the duration of the pause. Therefore, the resulting discrete sequential moments (in each of them there is an update of the “reality”) of a person’s own time, which contain in their sequence all the paintings and all the events of life for a person, merge into a continuous, inseparable flow in his mind.

Each person, starting from the moment of birth, selects through sensations from a diverse environment only those information that can be deciphered, or information, in accordance with the achieved level of consciousness development (shaping abilities). The holographic approach to the structure of consciousness fully reflects the connections of various regions of the brain.

Holographic Recording of Internal Speech

Magnetic resonance imaging (MRI) today is used not only for diagnostics, but also for mapping the functional state of neural networks, allowing you to literally see the brain’s work in real time [20-24].

The ability to directly observe the dynamics of cognitive (cognitive) brain activity appeared only with the introduction of functional magnetic resonance imaging technology into research practice.

A little more than two decades ago, employees of the American research organization AT&T Bell Laboratories described the principle of visualizing the activity of brain zones in real time using magnetic resonance imaging (MRI). A dynamic study of active zones of brain structures at the time of their activity was first tested on a person two years after the first publication.

MRI (magnetic resonance imaging) is a diagnostic procedure based on the effect of nuclear magnetic resonance. Modern MRI techniques allow not only to visualize organs with high quality, but also to investigate their function. Due to the absence of ionizing radiation, this method can be used without restrictions and repeated studies are repeatedly carried out.

It follows that the relative magnitude of the MRI signal can serve as a measure of the activity of brain zones. Moreover, the results obtained under the control of electroencephalography on the visual cortex of the primate open brain suggest that the MRI signal is a linear response to the electrical activity generated by the active neural ensemble.

Functional MRI focused on BOLD effect detection is today the optimal tool for mapping neuronal activity, more precisely, the functional state of neural networks – the basis for visualizing our holographic images in real time.

Closely related to fMRI technology is the neurobiological technology “of the brain-computer interface. We are talking about the possibility with the help of an electroencephalogram to obtain a display of a stable hologram of the bioelectric activity of the brain, tying it to the function of brain structures and the formation of new stable neural ensembles in them. The electroencephalogram is a source of information on intracerebral events. At the same time, fMRI makes it possible to visualize the real temporal and spatial dynamics of the brain. If you briefly describe the most general route of activation of brain structures during internal speech, then after the start, the broad cortical fields of the brain are first involved in the work, and the cognitive route in the cerebellum ends.

Psychology is one of the most promising areas of use of neuroimaging technology by FMRT, because this scientific field is practically devoid of ideas about the localization (in the anatomical sense) of cognitive functions.

In one of the works of American researchers, an attempt was made to answer the question of the localization of brain structures designed to classify such cognitive categories as equality and efficiency. It turned out that the emotional assessment of the “effectiveness,” “justice” and “general benefit” of the decision is carried out by three different brain structures. The brain department, called the “shell” (lat. Putamen), is responsible for efficiency, the bark of the “islet” (lat. Insula) protects the interests of justice, a cumulative measure of efficiency and inequality, that is, utility, assesses the septal organ (lat. Septum), while other areas of the brain are involved in the cognitive process.

The development of cognitology, a direction of neurosciences that studies the basic mechanisms of the brain’s work: “mental strategies,” their localization, dynamics, ways of using and improving in everyday life, also opens up great prospects. The so-called “interactive stimulation” makes it possible to organize training feedback directly through the “interested” brain structure (Figure 2).

fig 2

Figure 2: Brain functions

By visualizing the cingulate gyrus or hippocampus, you get a chance of “direct conversation” with the brain. Knowing how the brain is activated, you can restore the holographic image of internal speech by a resonant energy trace. Using nanoresonators with Fourier transducers, brain activity of human internal speech holographic image can fix mental noninvasive neurointerface in language form by mental lexicon [25,26].

Conclusion

Thanks to the development of holographic methods, technologies and the creation of smart neuroiterfaces, in the coming years humanity can move to a completely different world in which everything will be technological. Almost all modes of transport will be controlled through neurointerfaces with smart artificial intelligence. Human thinking will be a kind of hybrid of biological and non-biological. We are considering the prospect of connecting to the cloud from the human neocortex. Already, we can connect a computer to the human brain and thus convey feelings and emotions to the Internet. It will be possible to read memories and impressions from the human brain, transmit them over the Internet or even upload them to the brains of other people. This will open the way to turning the Web into a brain-net, that is, a brain-net. You will be able to share your memories and load them into a break-no, and then loved ones with their eyes and heart knock via smart neurointerface will survive your events and experience joy. Neurointerfaces with intelligent artificial intelligence and technological singularity are already in demand in the industrial and social spheres. Especially in environments and situations incomprehensible to the consciousness of specialists, where huge risks arise.

References

  1. Chuprikova NI (2017) Differential integration theory of development as the basis for solving the problem of the relationship of language and thinking. Differential Integration Theory of Development 2: 165-190.
  2. Gazzaniga, Michael S, Richard B Ivry, Mangun GR (2014) Cognitive Neuroscience: the Biology of the Mind. Fourth edition. New York: W. W. Norton & Company, Inc.
  3. Roux FE, Boulanouar K, Lotterie JA, Mejdoubi M, LeSage JP, et al. (2003) Language functional magnetic resonance imaging in preoperative assessment of language areas: correlation with direct cortical stimulation. Neurosurgery 52: 1335-1347. [crossref]
  4. Friederici AD, Weissenborn J (2007) Mapping sentence form onto meaning: The syntaxโ€“semantic interface. Brain research 1146: 50-58. [crossref]
  5. Penfield W, Roberts L (2014) Speech and brain mechanisms. Princeton University Press.
  6. Sidtis DVL, Rogers T, Godier V, Tagliati M, Sidtis JJ (2010) Voice and fluency changes as a function of speech task and deep brain stimulation. Journal of speech, language, and hearing research 53: 1167-1177. [crossref]
  7. Chang EF, Raygor KP, Berger MS (2015) Contemporary model of language organization: an overview for neurosurgeons. Journal of neurosurgery 122: 250-261. [crossref]
  8. Hickok G, Poeppel D (2007) The cortical organization of speech processing. Nature reviews Neuroscience 8: 393-402. [crossref]
  9. Sarubbo S, Benedictis AD, Maldonado IL, Basso G, Duffau H (2013) Frontal terminations for the inferior fronto-occipital fascicle: anatomical dissection, DTI study and functional considerations on a multi-component bundle. Brain Structure and Function 218: 21-37. [crossref]
  10. Mandonnet E, Nouet A, Gatignol P, Capelle L, Duffau H (2007) Does the left inferior longitudinal fasciculus play a role in language? A brain stimulation study. Brain 130: 623-629. [crossref]
  11. van der Lely HKJ, Pinker S (2014) The biological basis of language: Insight from developmental grammatical impairments. Trends in Cognitive Sciences 18: 586-595. [crossref]
  12. Specht K (2013) Mapping a lateralization gradient within the ventral stream for auditory speech perception. Frontiers in human neuroscience 7: 629.
  13. Bemis DK, Pylkkรคnen L (2012) Basic linguistic composition recruits the left anterior temporal lobe and left angular gyrus during both listening and reading. Cerebral Cortex 23: 1859-1873. [crossref]
  14. Friederici AD, Bahlmann J, Heim S, Schubotz RI, Anwander A (2006) The brain differentiates human and non-human grammars: functional localization and structural connectivity. Proceedings of the National Academy of Sciences of the United States of America 103: 2458-2463. [crossref]
  15. Price CJ (2010) The anatomy of language: a review of 100 fMRI studies published in 2009. Annals of the New York Academy of Sciences 1191: 62-88. [crossref]
  16. Hรคberling IS, Steinemann A, Corballis MC (2016) Cerebral asymmetry for language: comparing production with comprehension. Neuropsychologia 80: 17-23. [crossref]
  17. Witteman J, Goerlich-Dobre KS, Martens S, Aleman A, Van Heuven VJ, et al. (2014) The nature of hemispheric specialization for prosody perception: ERP evidence. Towards a Cognitive Neuroscience of Prosody Perception 63.
  18. Mitchell RLC, Ross ED (2013) Attitudinal prosody: What we know and directions for future study. Neuroscience & Biobehavioral Reviews 37: 471-479. [crossref]
  19. Frรผhholz S, Gschwind M, Grandjean D (2015) Bilateral dorsal and ventral fiber pathways for the processing of affective prosody identified by probabilistic fiber tracking. Neuroimage 109: 27-34. [crossref]
  20. Bakulin IS, Poydasheva A, Medyntsev A, Suponeva N, Piradov MA (2020) Transcranial magnetic stimulation in cognitive neuroscience: Methodological basis and safety. Russian Journal of Cognitive Science 7: 25-44.
  21. Lanfang Liu, Xin Yan, Hehui Li, Dingguo Gao, Guosheng Ding (2020) Identifying a supramodal language network in human brain with individual fingerprint. NeuroImage 220: 117131. [crossref]
  22. Nima Asadi, Yin Wang (2020) A heuristic information cluster search approach for precise functional brain mapping. Human Brain Mapping 41: 2263-2280. [crossref]
  23. Xiaoxiao Wang, Xiao Liang, Zhoufan Jiang, Benedictor Nguchu A, Yawen Zhou, et al. (2020) Decoding and mapping task states of the human brain via deep learning. Human Brain Mapping, 41: 1505-1519.
  24. Takumi Mitsuhash, Masaki Sonoda, Jeong-Won Jeong, Brian Silverstein H, Hirotaka Iwaki, et al. (2021) Four-dimensional tractography animates propagations of neural activation via distinct interhemispheric pathways. Clin Neurophysiol 132: 520-529. [crossref]
  25. Evgeny Bryndin (2021) Mental Communication of Internal Speech with Communicative Associative Robot via Spectral Neurointerface. American Journal of Applied Psychology 10: 55-64.
  26. Evgeny Bryndin (2021) Resonance Technology of Communication of Specialists via Mental Neurointerfaces. International Journal of Neurologic Physical Therapy 7: 7-13.

Alternative Treatments of Postpartum Uterine Diseases in Dairy Cows

DOI: 10.31038/IJVB.2021534

Abstract

The ultimate goal of treating postpartum uterine diseases (PUDs) in dairy cows is to reach clinical cure in a reasonable amount of time and to improve reproductive performance while minimizing milk and meat residue issues, and consequently, reducing economic losses. Even though some local antibiotic treatments are effective to mitigate the effect of PUDs, veterinarians will eventually use more natural alternatives to meet the global context of antimicrobial resistance and protect human and animal health. Research advances have improved our understanding of the uterine involution and the ethiopathology of the different pathological postpartum conditions in dairy cows. This has opened new therapeutic and preventive approach, however, most recent research is still in the early experimental stages and under scrutiny. The aim of the present article is to review non-antibiotic approaches used to treat or prevent PUDs in dairy cows. The authors include: Chitosan microparticles, essential oils, mannose, bacteriophages, dextrose, paraffin, ozone, probiotics, antiseptics, homeopathy, apitherapy, vaccines, pegbovigrastim, recombinant IL-8, and genomic selection.

Keywords

Postpartum uterine diseases, Dairy cows, Reproductive performance, Alternative treatments, Non-antibiotic

Introduction

The ultimate goal of treating postpartum uterine diseases (PUDs) in dairy cows is to reach clinical cure in a reasonable amount of time and to improve reproductive performance while minimizing milk and meat residue issues, and consequently, reducing economic losses. Acute puerperal metritis in cows is usually treated with systemic antimicrobial drugs (cephalosporin, or tetracycline, ceftiofur, penicillin) and a fluid therapy in severe cases [1]. Because of concerns about antibiotic resistance and residues, some veterinarians advocate waiting 24 h to 48 h before instituting an anti-microbial therapy, thus allowing a spontaneous cure of about 30% [2]. In severe cases, this is frequently not advised in order to protect the welfare of the animal. Indeed, manipulation of the uterus and drainage of the fetid watery red-brown discharge are not recommended because of the risk of perforation of the friable and painful uterine wall and bacteremia [3]. There is no evidence of improvement of the clinical condition or reproductive efficiency with other treatments, such as estrogen [4] which is now illegal in many countries, or oral calcium [5]. In cases of pyometra, PGF2a or its analogue [6] is the treatment of choice, allowing luteolysis of the persistent corpus luteum, expulsion of uterine exudates, and reduction of the bacterial load in 90% of cases with a recurrence rate of about 10% [7], in which case the PGF2a treatment should be repeated. In refractory cases, a local antibiotic may be added to the second injection of PGF2a. Veterinarians need to remember that the use of intrauterine nitrofurazone infusion has been known to reduce conception rates. Endometritis (clinical and subclinical) is most often treated with intrauterine infusion of a specific formulation of cephapirin (Metricure, Merk) which has beneficial effects on clinical cure and subsequent reproductive performance [8-12]. Although prostaglandins are still used for treatment and prevention of endometritis, there is no evidence of efficacy neither for improving reproductive efficiency nor for reducing its incidence [2], Lefebvre and Stock 2012). However, this hormone is essential in synchronization protocols for controlled breeding programs. The aim of the present article is to review non-antibiotic approaches used to treat or prevent PUDs in dairy cows.

Alternative Medicine

Veterinarians could substitute antibiotics for natural alternatives, especially in the global context of antimicrobial resistance and given the World Health Organizationโ€™s position on the use of medically important antibiotics and the One Health program. Despite the well documented detrimental impact of PUDs on the cow reproductive health, treatment and prevention practices of farmers are not always recorded and consistent. For example, [13] have shown significant disparity as to how farmers treat metritis. To mitigate the impact of PUDs, several non-antimicrobial therapies to treat or prevent uterine diseases have been proposed. However, most of them are still in the early experimental stages and under scrutiny. In addition, the scientific merit of most in vivo studies seems to be compromised by experimental factors: absence of precise clinical definition, inconsistencies of outcomes, lack of negative controls, insufficient numbers of animals per treatment group, use of inadequate or rebutted diagnostic methods, disparity in the studied population, lack of randomization, and faulty experimental design. However, these studies carry forward the limits of our understanding and provide a different perspective on the treatments of PUDs in dairy cows. These new approaches include: Chitosan microparticles, essential oils, mannose, bacteriophages, dextrose, paraffin, ozone, probiotics, antiseptics, homeopathy, apitherapy, vaccines, pegbovigrastim, recombinant IL-8, and genomic selection. These alternative therapies attempt to improve the avoidance (chitosan, mannose, dextrose), the tolerance (probiotic, paraffin, and ozone), and resistance (pegbovigrastim, recombinant IL-8, and genomic selection) of defense mechanisms in the genital tract of dairy cows.

Alternative Therapy for PUDs

Chitosan is recognized by the FDA and synthesized from chitin of the exoskeleton of arthropods and cell walls of certain fungi and yeast and has a large antimicrobial spectrum in neutral and acidic environment [14]. The normal pH of the cowโ€™s genital tract is neutral between 6.84 and 7.51 [15]. The product claims to improve the cowโ€™s resistance by reducing the uterine bacterial load. More specifically, the antimicrobial activity of chitosan microparticles is associated with the disruption of the bacterial cell membranes by interactions with the outer membrane protein A (OmpA) leading to cell death [14]. The cows with metritis were administered 24 g (in 40 ml of sterile distilled water) of chitosan particles in the uterus for 3 days (D0; day of diagnosis, D2, and D4), and compared to ceftiofur crystalline-free treatment (6.6 mg/kg SC in the base of the ear at D0 and D3) or no treatment at all as the control group [16]. No improvement of clinical sings was measured. However, the treatment decreased milk production, reproductive performance (conception rate at first AI, and pregnancy rate at 300 DIM), and survival rate of treated cows compared to the control group [16]. Case definition and the number of local treatments may have rendered the results even more uncertain. Therefore, intrauterine use of chitosan is not recommended in dairy cows.

Essential oils (about 3000) are volatile substances naturally produced by plants as secondary metabolites and are known for their antibacterial, antifungal, insecticidal, and antiviral properties. The special biological properties and fragrance of essential oils are in a great portion due to terpenes and phenylpropanoids [17]. An important point to know is that essential oils have several compounds and their bioactivities result from the complex interactions between the different classes of compounds. Essential oils have antioxidative, anti-inflammatory, and antimicrobial properties making them good candidates in infectious process like UPDs [18]. A compound of certified organic essential oils (Optimum UterFlush, Van Beek Natural Science, Orange City, IA, n=107) was infused every other day for a total of 3 times between 1 and 12 DIM in the uterus of puerperal toxic metritis dairy cows and the results were compared to the intrauterine iodine povidone infusion group (n=113), and the control group (health cows, n=400) in organic farms [19]. The first service conception rates were 23%, 37%, and 38% in cows infused with iodine, the essential oils and the control group of healthy cows respectively (p=0.05). At 150 DIM, 75%, 31.1%, and 44.8% were pregnant in the healthy, iodine, and Optimum Uterflush groups respectively. The survival analyses indicated a tendency to shorten the interval from calving to first AI (P=0.08). The odds of pregnancy at 150 DIM for cows with Optimum Uterflush group was 1.81 times the odds of cows infused with iodine. In the study, all cows received intravenous calcium and hypertonic saline in addition to oral aspirin. The effect of Optimum UterFlush was not tested on healthy cows. The first results are very encouraging and further research on a larger scale is needed.

Carbohydrate

Three rationales have motivated researchers to use sugars as intrauterine remedy for postpartum uterine infections: 1) sugars disrupt attachment of bacteria to tissues, 2) sugars inhibit microbial growth, and 3) sugars are hypertonic and attract fluid in the uterus and facilitate eviction of debris and bacteria when the uterine cervix opens. Often lectins present on the surface of the infectious organism bind to complementary carbohydrates on the surface of the host tissues. In this way, the pathogen is not washed away by natural cleansing system of the host. Furthermore, the adhesion represents a good source of nutrition, facilitates the delivery of the toxins, and eventually the penetration of the bacteria into the tissues. The lectins present elongated multi-protein appendages with sugars (typically saccharides) on the surface of bacteria increase infectiousness (ex. fimH for E. coli) for the organism [20]. Anti-adhesion therapy consists in the inhibition of these lectins by suitable carbohydrates for prevention or treatment of microbial diseases. Mannose [21] and 50% dextrose [22-25] have been tested in cows with metritis and endometritis. Since the publication of the ability of mannose to block growth of E. coli in human wounds and to inhibit its adhesion on endometrial cells in mares with endometritis [26], research has been done in cows with PUDs. Adhesion of pathogenic organisms to host tissues is often the prerequisite for the initiation of infectious diseases. By inhibiting bacterial adhesion to the cell membrane (like endometrial cells), the risk of initiating infection should be lower. The hyperosmotic effect of the high concentration of sugar may also inhibit growth by breaking down bacterial membrane of bacteria. Mannose was used to reduce the risk of metritis in dairy cows [27] by administration of 50 g of sugar intrauterine 2 days after calving. The treatment was not successful in improving uterine health in treated cows compared to those receiving the placebo. Similarly, 200 mL of 50% dextrose solution infused intrauterine of endometritis cows at about 30 DIM did not improve neither the cure rate, the first conception rate, nor the calving-to-conception interval [22,23]. However, the cure rate of endometritis was improved with the dextrose treatment in other studies [25]. Nevertheless, it improved the median of days open compared to systemic treatment ceftiofur or no treatment at all (control). Also, the resulting accumulation of transudate in the uterus after infusion of dextrose is not well documented. Thus far, treatment of metritis and endometritis using 50% solution of dextrose remains to have sound results.

Parafin

Intrauterine infusion of liquid paraffin for endometritis has been proposed to increase the resilience of the uterus in the postpartum period. Unfortunately, the condition of cows with endometritis infused with 100 ml at around 30 DIM did not improve, but instead, sustained a reduction in their reproductive performance [22]. Without additional studies, liquid paraffin should not be considered, as an option for the treatment of endometritis in dairy cows.

Ozone

Ozone is a gas consisting of 3 atoms of oxygen in a dynamic unstable structure essential for life on earth due to its ability to absorb wavelengths of harmful UV radiation coming from spectra of sunlight [28]. Because ozone manifests strong bactericidal, fungicidal, viricidal, yeasticidal, and protozocidal properties, it is used in medical therapies, and is available in different types of products: vegetal ozoned oil with emollient, cicatrizing, antibacterial, and hygienic compounds in several forms (creams, gasses, syringes, paillettes, foam, and boluses) [29]. Ozone inhibits growth of bacteria by damaging the capsule and cell membrane through the activity of peroxidases, and may block replication of bacterial DNA, and often acts as a supportive therapy in infectious diseases. Gram-positive bacteria seem more sensitive to ozone than Gram-negative bacteria. The most important activity of ozone is probably the synthesis of cell membrane enzymes like superoxide dismutase, catalase, and glutathione peroxidase to counter the damaging effects of O2 free radicals [30]. It reduces the cascade of pro-inflammation by promoting immunosuppressive cytokines like IL-10 and TNFรŸ1 by neutrophils, monocytes, and lymphocytes [31]. The therapeutic efficacy of ozone is most likely dependent on the strength of the oxidative stress produced. Moderate oxidative stress activates nuclear transcriptional factors (NrF2) suppressing NFkB and stimulating inflammatory responses. Ozone has been used to prevent [32] and treat [33,34] endometritis and metritis respectively with some positive effect. Even though ozone therapy is used in several human conditions (autohemotherapy, antineoplastic therapy, obstructive arterial diseases, macular degeneration, autoimmune diseases, and diabetes), it still not accepted yet as medical treatment in all countries [31]. In terms of efficacy of ozone in dairy cows with endometritis, the low number of animals in studies does not allow readers to draw clear conclusion.

Bacteriophage

The use of bacteriophages and phage-derived endolysins may represent an alternative treatment for PUDs in dairy cows [35]. Bacteriophages are host specific viruses of particular species or strains of bacteria. Phages produce endolysin which digests the bacterial wall, enters the cells and integrates the genome (prophage) of the host cell and replicates, resulting in lysis of the cell wall [36] in the biofilms produced by certain bacteria such as E. coli, T. pyogenes, coagulase-negative staphylococcus and S. aureus [37]. Intrauterine infusion of bacteriophages specific to E. coli and T. pyogenes 2 days prepartum and postpartum have shown no effect on uterine health and reproductive performance, instead, have increased the incidence of retained fetal membranes and metritis [21]. As for paraffin, the use of bacteriophages in PUDs in dairy cows is not recommended and more research is needed.

Probiotics

Probiotics are defined as live microorganisms that, when administered in adequate amounts, confer a health benefit on the host. Probiotic products include probiotic-containing drugs, medical and conventional foods, dietary supplements, and animal fodder. However, it excludes microbial transplants, fermented foods, dead microbes, and microbial products such as protein, polysaccharide, and nucleotide components. Probiotics work by producing substances that have desirable effects on the body like improving the immune response or maintaining a healthy microbiome [38]. In humans, probiotics have shown promises for the prevention of antibiotic-associated diarrhea (Clostridium difficile), necrotizing enterocolitis, sepsis, and for treatment of infant colic, periodontal diseases, and ulcerative colitis. Prebiotics are not the same as probiotics since prebiotics are food components that selectively stimulate the growth or activity of desirable microorganisms. Probiotics may contain a variety of microorganisms, but one of the most common is Lactobacillus which is the major member of the vaginal microbiome in women. In dairy cows, several doses of cocktails of lactic acid were infused in the vagina (before calving) and in the uterus (after calving) to measure the effect on the incidence of metritis and endometritis [39-41]. Treatments with the lactic acid cocktails reduced the incidence of metritis and endometritis, improved vaginal mucus secretion of immunoglobulin A, and decreased the inflammatory response by reducing neutrophil gene expression. Therefore, intravaginal and intrauterine infusion of probiotics seem effective in reducing the incidence of PUDs. The probiotic functionality and efficacy are species specific and therefore, different cocktails may have different effects.

Apitherapy

Another alternative way to treat PUDs is apitherapy. Honey products have been used extensively since ancient times for anti-putrefactive (mommies), antiseptics, cicatrizant, anti-inflammatory, antimicrobial, antioxidant agents [42], and antibiofilm activities [43,44]. It is an influential antioxidant and a free radical scavenger. Nonetheless, for several decades now, modern medicine, propelled by new developments and the wide applications of antibiotics, in which the honey as medical treatment has be sunk into oblivion. Given the repeated occurrence of antibiotic resistance, there has been renewed interest in the medical applications of honey products (propolis, venom, royal jelly, venom, and pollen) for livestock. The active components of honey, such as glucose, fructose, flavonoids, polyphenols, and organic acids are largely responsible for its therapeutic activity. For example, flavonoids found in honey have been shown to induce apoptosis and prevent the release of IL-1รŸ, Il-6, TNFa, iNOSm and Cox-2 [45]. The propolis has antifungal properties and can be used as an antibiofilm [46]. Honey possesses therapeutic potential and its antimicrobial activity is widely documented as a large number of in vitro studies of MIC and MBC confirmed its broad-spectrum antimicrobial properties [47]. The immunomodulatory response to honey products also manifests itself in the activation of lymphocytic function, the activation of macrophages, and the stimulation of cytokines release by monocytes [48]. Abdul-Hafeez et al. (2019) infused 100 ml of 70% Egyptian cotton honey for 3 consecutive days in the uterus of repeat breeder dairy cows (n=16) with purulent vaginal discharge unresponsive to standard antibiotherapies and obtained 75% conception rate at first insemination after treatment. However, the small number of animals in the study does not allow us to draw any definite conclusions.

Homeopathy was introduced by Samuel Hahnemann around 1797 as a new method to treat diseases with dilute remedies. There are 3 major fundamental principles of homeopathy: 1) law of similia, 2) law of simplex (the single remedy), and 3) law of minimum. The law of similia means โ€œlike cures likeโ€, the medicine must have the capability of producing similar symptoms of the disease to cure a person. Hahnemann stated that only one single and simple medicinal substance is to be administered in a given case of time. The reason for this is that if more than one remedy is used, the doctor will never know which element was curative and the different ingredients may even result in interactions that may have adverse effects in the body. The third law is probably the most debated. Under this principle, the quantity of medicine given to a patient is minimum and appropriate for a gentle remedial effect to avoid any aggravation.

In the scientific community and veterinary practice, the use of homeopathy in food-producing animals is controversial even though it is common practice on organic farms. As the other alternatives, the development of the homeopathy is fueled by overuse of antibiotic in humans and animals which has promoted the antibiotic resistance [49]. The mechanism of action of homeopathic drugs are not known however for example, Lachesis is used for several inflammatory conditions including uterine infection because it is believed that it stimulates the local immune defense and helps the mucosa to regenerate [50,51]. In ruminants, clinical trails reported on uterine infections in dairy cows [52]. Homeopathic studies on fertility addressed especially the peripartum period (retained placenta, endometritis) and almost exclusively in a preventive instead of the therapeutic approach. In a randomized, controlled, and double-blinded clinical trial, [53] compared three different mixed formulas of homeopathic remedies (Traumeel, Lachies, and Carduus administered IM) in dairy cows with clinical endometritis at calving, 7 to 13 DIM, 14 to 20 DIM, and 21 to 27 DIM. In contrast to the second law, the researchers did not use an individualized therapy. The homeopathic treatments were not effective in preventing endometritis or improving the metabolic condition and the reproductive performance. Another randomized, controlled, and blinded trial with 105 cows with compound remedies resulted in a significant reduction of noncycling cows compared to the control group [54]. Homeopathic treatments reduced significantly the number of days to pregnancy [55] and fewer services per conception [50]. No trial was repeated in a comparative manner. Due to low number and quality of studies available (high risk of bias), there are limited evidence for statistical difference between homeopathic remedies and the control.

Antiseptics (chlorhexidine, propylene glycol, lugolโ€™s iodine, iodine, polyvinyl-pyrrolidon-iodine, formaldehyde, and Betadine solutions) have been routinely used in veterinary practice for many years to treat postpartum uterine infections in dairy cows [56,57]. It was postulated that intrauterine infusion of irritating antiseptics would trigger an acute inflammation transforming chronic endometritis into an acute condition (local irritation) by stimulating the uterine immune defense [58]. Antiseptics have also an microbiocidal effect. In addition, it is expected that a local condition like endometritis could be treated locally (intrauterine infusion). Intrauterine infusions of 2% and 4% polycondensated m-cresolsulphuric acid formaldehyde in dairy cows with endometritis between 22 and 28 DIM did not improve the conception rate compared to the prostaglandin treatment [59,60]. Similar results were obtained with intrauterine infusion of 2% polyvinylpyrrolidone-iodine at 35 DIM [57], n = 531) which was detrimental to reproductive efficiency. However, no detrimental effect was measured in cows without endometritis. [61] infused in the uterus 100 ml of Betadine without improvement of the reproductive performance compared to intrauterine infusion of antibiotics or intramuscular prostaglandins. The reduction of the reproductive performance with intrauterine infusion of antiseptics may be associated with the irritating effect on the endometrium which could have caused fibrosis. Another concern about the infusion of iodine derivatives into the uterus is the significant increase of iodine concentrations in the milk [62,63]. In conclusion, irritation of the endometrium by intrauterine infusion of antiseptics has a negative effect on uterine defense and reduces self-healing ability. Unfortunately, several studies are typically lacking negative controls and insufficient numbers of animals per treatment group as well as a faulty experimental design with absence of randomization.

Alternative Prevention to Reduce PUD Incidence Rates

In the past decade, research on innate immunity has provided a better understanding of the PUD etiopathology in dairy cows, but the potential role of adaptive immunity in postpartum uterine defense is not yet perfectly understood and the production of a vaccine against metritis is still in the early stages of development [64,65]. The lymphocyte population composed of B-cells, T-cells, and NK cells were found in endometrium of cows [16]. Authors noted that the B-lymphocyte population in water buffaloes was widely distributed through the endometrium, the stroma, and the luminal and glandular epithelium, and the myometrium compared to the population of CD4, CD8, and NK cells. At the moment, four studies have used different vaccine formulations targeting E. coli, and T. pyogenes as major pathogens with or without virulence factors (FimH, Leukotoxin, pyolosin), and Bacteroides and streptococcus uberis as secondary bacteria [66-69]. Of the four studies, only one measured the serological response based on blood levels of IgG specific to the antigens utilized in the vaccine formulation [67]. Inoculations of the vaccines were done with whole cells orally, intravaginally, or subcutaneously in heifers or cow. Two out of the four studies succeeded in reducing the incidence of metritis [67,68] and one led to an improvement of reproductive efficiency [67]. In addition, milk production was increased in the first 30 DIM in multiparous cows [68]. The difference in efficacy among these studies may be related to the vaccine formulation, and therefore, more research is warranted to replicate the findings regarding the efficacy of a vaccine against metritis. Another approach to improve the immune defense of cows in peripartum has been the use of Pegbovigrastim. This molecule is a recombinant bovine granulocyte colony-stimulating factor (G-CSF) which is a hematopoietic growth factor that stimulates the production and differentiation of neutrophils by the bone marrow [70]. Subcutaneously administered pegbovigrastim 7 days before the expected calving date and 1 day after calving increased of circulating neutrophils counts but did not decrease the incidence of PUDs [71] forcing its removal from the market. A similar strategy using recombinant IL-8 (rbIL-8) was proposed to reduce PUDs. The IL-8 is a pro-inflammatory cytokine which attracts and activates neutrophils into the inflammatory tissues, stimulates their chemotaxis, and increases phagocytosis and killing ability [72]. Intrauterine infusions of high and low doses of rbIL-8 within 12 h of calving in dairy cows were adequate to decrease metritis incidence and increase milk production compared to control cows [73,74]. If large studies confirm these preliminary results, rbIL-8 could have a promising impact on dairy farms.

The best way to increase efficiency of farms is to prevent diseases. Genomic and genetic studies attempted to validate genomic prediction analysis by taking advantage of the disparity between the worst and the best herds in the incidence of reported diseases [75] and incorporating the data in a selection program. For a long time, practitioners have observed large differences in PUD incidence rate among herds. Nonetheless, the heritability of uterine diseases is low. Even though genetic heritability for metritis (0.05) and endometritis (0.04) is actually very low, geneticists used Bayesian statistical models and high-density SNP panels to estimate genomic predictive values of uterine health traits (PUDs) in Holstein cows in a more efficient way [76]. Taking into account the increase in genomic testing, these tools may soon become part of a preventive program against PUDs.

Conclusion

Despite the documented positive impact of intrauterine infusion of antibiotics for the treatment of PUDs in dairy cows, the global context of antimicrobial resistance compels veterinarians to substitute antibiotics with alternatives to mitigate the impact of PUDs reproductive performance and productivity of cows. Several non-antimicrobial therapies to treat and prevent PUDs have been proposed. However, most of them are still in the early experimental stages.

References

  1. Gilbert RO (2016) Management of reproductive disease in dairy cows. Vet Clin Food Anim 32: 387-410. [crossref]
  2. Haimerl P, Arlt S, Heuwieser W (2012) Evidence-based medicine: quality and comparability of clinical trials investigating the efficacy of prostaglandin F (2a) for the treatment of bovine endometritis. J Dairy Res 79: 287-296. [crossref]
  3. Gilbert RO, Schwark WS (1992) Pharmacologic considerations in the management of peripartum conditions of the cow. Vet Clin North Am Food Anim Pract 8: 29-56. [crossref]
  4. Risco CA and Hermandez J. (2003) Comparison of ceftiofur hydrochloride and estradiol cypionate for metritis prevention and reproductive performance in dairy cows affected with retained fetal membrane. Theriogenology 60: 47-58. [crossref]
  5. Hermandez J, Risco CA, Elliot JB (1999) Effect of oral administration of a calcium chloride gel on blood mineral concentration, parturient disorders, reproductive performance, and milk production of dairy cows with retained fetal membranes. J Am Vet Med Assoc 215: 72-76. [crossref]
  6. El-Tahawy Ael G and Fahmy MM (2011) Partial budgeting assessment of the treatment of pyometra, follicular cyst, and ovarian inactivity causing postpartum anoestrus in dairy cows. Res Vet Sci 90: 44-50.
  7. Zwald NR, Weigel KA, Chang YM, Welp RD, et al. (2004) Genetic selection for health traits using producer-recorded data. I Incidence rates, heritability estimates, and sire breeding values. J Dairy Sci 87: 4287-4294. [crossref]
  8. Kasimanickam R, Duffield TF, Foster RA, Gartley CJ, et al. (2004) Endometrial cytology and ultrasonography for the detection of subclinical endometritis in postpartum dairy cows. Theriogenology 62: 9-23. [crossref]
  9. LeBlanc SJ, Duffield TF, Leslie KE, et al. (2002) The effect of treatment of clinical endometritis on reproductive performance in dairy cows. J Dairy Sci 85: 2237-2249. [crossref]
  10. Tison N, Bouchard E, DesCรดteaux L, Lefebvre R (2017) Effectiveness of intrauterine treatment with cephapirin in dairy cows with purulent vaginal discharge. Theriogenology 89: 305-317. [crossref]
  11. Runciman DI, Anderson GA, Malmo I et al. (2008) Effect of intrauterine treatment with cephapirin on the reproductive performance of seasonally calving dairy cows at risk of endometritis following periparturient disease. Aust Vet J 86: 250-258. [crossref]
  12. Denis-Robichaud J and Dubuc J (2015) Randomized clinical trial of intrauterine cephapirin infusion ion dairy cows for the treatment of purulent discharge and cytological endometritis. J Dairy Sci 98: 6856-6864. [crossref]
  13. Espadamala A, Pereira R, Pallares P, Lagao A, et al. (2018) Metritis diagnosis and treatment practices in 45 dairy farms in California. J Dairy Sci 101: 9608-9616. [crossref]
  14. Jeon SJ, Oh M, Yeo WS, Galvao KN, Jeong KC (2014) Underlying mechanism of antimicrobial activity of chitosan microparticles and implication for the treatment of infectious diseases. Plos One 9: 1-10. [crossref]
  15. Ozenc E, Seker E, Dogan N (2010) The effect of bacterial flora on uterine pH values, observed during the estrus cycle, gestation, and in the cases of clinical metritis in cows. J Anim Vet Adv 9: 3000-3004.
  16. Oliveira EB, Cunha F, Daetz R, Figueiredo C, et al. (2020) Using chitosan microparticles to treat metritis in lactating dairy cows. J Dairy Sci 103: 7377-7391.
  17. Raut JS, Karuppayil SM (2014) Review A status review on the medicinal properties. Industrial Crops and Products 62: 250-264.
  18. Burt S (2004) Essential oils: their antimicrobial properties and potential applications in foods: a review. Int J Food Microbiol 94: 223-253.
  19. Pinedo PJ, Velez JS, Bothe H, Pineiro JM, Risco CA (2015) Effect of intrauterine infusion of an organic-certified product on uterine health, survival, and fertility of dairy cows with toxic puerperal metritis. J Dairy Sci 98: 3120-3132. [crossref]
  20. Sharon N (2006) Carbohydrates as future anti-adhesion drugs for infectious diseases. Biochimica et Biophysica Acta 1760: 527-537. [crossref]
  21. Machado VS, Bicalho ML, Pereira RV, Caixeta LS, et al. (2012) The effect of administration of mannose or bacteriophages on uterine health, and fertility of dairy cows with special focus on Escherichia coli and Arcanobacterium pyogenes. J Dairy Sci 95: 3100-3109. [crossref]
  22. Ahmadi MR, Makki M, Mirzaei A, Gheisari HR (2019) Effects of hypertonic dextrose and paraffin solution as non-antibiotic treatments of clinical endometritis on reproductive performance of high producing dairy cows. Reprod Domest Anim 54: 762-771. [crossref]
  23. Machado VS, Oikonomou G, Ganda EK, Milhomem M et al. (2015) The effect of intrauterine infusion of dextrose on clinical endometritis cure rate and reproductive performance of dairy cows. J Dairy Sci 98: 3849-3858. [crossref]
  24. Marquivar MG, Barragan AA, Velez JS, Bothe H et al. (2015) Effect of intrauterine dextrose on reproductive performance of lactating dairy cows diagnosed with purulent vaginal discharge under certified organic management. J Dairy Sci 98: 3876-3886. [crossref]
  25. Brick TA, Schuenemann GM, Bas S, Daniels JB, Pinto CR, Rings, Rajala-Schultzt PJ (2012) Effect of intrauterine dextrose or antibiotic therapy on reproductive performance of lactating dairy cows diagnose with clinical endometritis. J Dairy Sci 95: 1894-1905. [crossref]
  26. King SS, Carnevale EM, Nequin LG, Crawford JJ (1998) Inhibition of bacterial endometritis with mannose. J Equine Vet Sci 18: 332-334.
  27. Bicalho ML, Machado VS, Oikonimou G, Gilberts RO, Bicalho RC (2012) Association between virulence factors of Escherichia coli, Fusobacterium necrophorum, and Arcanobacterium pyogenes and uterine diseases of dairy cows. Vet Microbiol 157: 125-131. [crossref]
  28. Di Paolo N, Bocci V, Gaggioti E (2004) Ozone therapy editorial review. Int J Artif Organs 27: 168-175.
  29. Travagli V, Zanardi I, Bocci V (2009) Tropical applications of ozone and ozonated oils as anti-infective agents: an insight into the patent claims. In Recent patents on anti-infective drug discovery 4: 130-142. [crossref]
  30. Mandhare MN, Jagdale DM, Gaikwad PL, Gandhi PS, Kadam VJ (2012) Miracle of ozone therapy as an alternative medicine. Int J Pharm Chem Biol Sci 2: 63-71.
  31. Sagai M and Bocci V (2011) Mechanisms of action involved on ozone therapy: is healing induced via a mild oxidative stress? Med Gas Res 1: 29-31.
  32. Djuricic D, Vince S, Ablondi M, Dobranci T et al. (2012) Intrauterine ozone treatment of retained fetal membrane in Simmental cows. Anim Reprod Sci 134: 119-124. [crossref]
  33. Escandon BM, Espinoza JS, Perea FP, Quito F et al. (2020) Intrauterine therapy with ozone reduces subclinical endometritis an improves reproductive performance in postpartum dairy cows managed in pasture-based systems. Trop Anim Health Prod 52: 2523-2528. [crossref]
  34. Constantin T and Bรผrjoiu IA (2016) Preliminary study on ozone therapy in postpartum endometritis of dairy cows. Agriculture and Agricultural Science Procedia. 10: 384-389.
  35. Bicalho RC, Santos TM, Gilbert RO, Caixeta LS, et al. (2010) Susceptibility of Escherichia coli isolated from uteri of postpartum dairy cows to antibiotic and environmental bacteriophages. Part I: isolation and lytic activity estimation of bacteriophages. J Dairy Sci 93: 93-104. [crossref]
  36. Kutter E, Sulakvelidze A (2004) Bacteriophages: Biologiy and Applications. 2004. CRC Press Boca Raton, Florida ISBN: 9780849313363.
  37. Chan BK and Abedon ST (2015) Bacteriophages and their enzymes in biofilm control. Curr Pharm Des 21:85-89. [crossref]
  38. Sanders MA (2015) Probiotic in 2015: their scope and use. J Clin Gastroenterol 49: S1-S5. [crossref]
  39. Deng Q, Odhiambo JF, Farooq U, Dunn SM, et al. (2015) Intravaginal lactic acid bacteria modulated local and systemic immune responses and lowered the incidence of uterine infections in periparturient dairy cows. Plos One 10: e0124167. [crossref]
  40. Genis S, Cerri RLA, Bach A, Silper BF, et al. (2018) Pre-calving intravaginal administration of lactic acid bacteria reduces metritis prevalence and regulates blood neutrophil gene expression after calving in dairy cattle. Front Vet Sci 5: 135-141. [crossref]
  41. Ametaj BN, Iqbal S, Selami F, Odhiambo JF, et al. (2014) Intravaginal administration of lactic acid bacteria modulated the incidence of purulent vaginal discharges, plasma haptoglobin concentrations, and milk production in dairy cows. Res Vet Sci 96: 365-370. [crossref]
  42. Pasupuleti VR, Sammugam L, Ramesh N, Gan SH (2017) Honey, propolis, and Royal Jelly: a comprehensive review of their biological actions and health benefits. Oxidative Medicine and Cellular longevity. 2017: 21-42. [crossref]
  43. Zine EL Abidne K, Bouabdellalh B (201) Dignosis and treatment of endometritis with intra-uterine infusion of a solution of honey 70% in mares. J Vet Sci Technol 9: 1000499.
  44. Shaun J, Duval M, Chan FT, Ferris W, SlingerR (2011) Methylglyoxal: active agent of manuka honey in vitro activity against bacterial biofilms. Inter Form Allergy and Rhinology 1-7.
  45. Erejuwa OO, Sulaiman SA, Wahab MSA (2014) Effects of honey and its mechanisms of action on the development and progression of cancer. Molecules 19:2497-2522. [crossref]
  46. Capoci LRG, Bonfim-Mendoรงa P, Arita GS, et al. (2015) Propolis in an efficient fungicide and inhibitor of biofilm production by vaginal Candida albican. Evidence-based. Complementary and alternative medicine. 2015:9-15. [crossref]
  47. Ameer AA, Abdul-Hafeez MM, Sayed SM et al. (2015) Minimum inhibitory and bactericidal concentrations (MIC, MBC) of honey and bee propolis against multidrug resistant staphylococcus sp. Isolated from bovine clinical mastitis. Global J Sci Frontier Res D Agri and Vet 15: 21-28.
  48. Sforcin JM (2007) Propolis and the immune system: a review. J Ethnopharmacol 113:1-14. [crossref]
  49. Laxminarayan R, DuseA, Wattal C, Zaidi AK et al. (2013) Antibiotic resistance-the need for global solutions. The Lancet Infectious Dieases 13: 1057-1098. [crossref]
  50. Boitor I, Bogdan ML, Ghitulescu C, Bogdan I (1994) Einsatz des Homoeopathika Lachesis compositum ad us. Vet. Bey puerperalen Uterusinfektionen und Ovarium compositium ad us. Vet Bei Ovarialzysten beim Rind Biol Tiermed 11: 44-49.
  51. Dorenkamp B (1991) Lachesis compositum ad us. Vet zur Behandlung von Puerperalerkrankungen. Biol Tiermed 8: 36-421.
  52. Doehring C and Sundrum A (2016) Efficacy of homeopahthy in livestock according to peer-reviewed publications from 1981-2014. Vet Rec 179: 628. [crossref]
  53. Arlt S, Padberg W, Drillich M and Heuwieser W (2009) Efficacy of homeopathic remedies as prophylaxis of bovine endometritis. J Dairy Sci 92: 4945-4953. [crossref]
  54. Enbergs H and Vorwig W (1995) Untersuchungen zur Praevention von postpartalen Zyklus- und Fruchtbarkeitsstoerungen bei Hochleistungskuehen durch die homoeopathischen Prรคparate Traumeel, Lachesis compositum und Carduus compositum. Biol Tiermed 95: 2-20.
  55. Enbergs H and Sensen B (200) Zur Effizienz homoeopathischer Behandlungen chronischer. Endometritiden von Milchkuehen. Prakt Tierarzt 88: 534-543.
  56. Hussain AM and Daniel RCW (1991) Bovine endometritis: current and future alternative therapy. J Vet Med A 38: 641-651. [crossref]
  57. Nakao T, Moriyoshi M, Kawata K (1988) Effect of postpartum intrauterine treatment with 2% polyvinyl-pyrrolidone-iodine solution on reproductive efficiency in cows. Theriogenology 30: 1033-1043. [crossref]
  58. Strube KR, Hรผhn R, Busch W, Werner E (1991) Ein Phagocytosetest zur Einschรคtzung der lokalen Abwehrsituation bei Endometritistherapie unter besonderer Berรผcksichtigung des Uterofertileinsatzes beim Rind. Dtsch Tierรคrtztl Wschr 98: 230-234.
  59. Heuwieser W, Tenhagen Ba, Tischer M, et al. (2000) Effect of three programmes for the treatment of endometritis on the reproductive performance of a dairy herd. Vet Rec 146: 338-341. [crossref]
  60. Feldmann, M., S. Tenhagen genannt Emming and M. Hoedemaker (2005). “[Treatment of chronic bovine endometritis and factors for treatment success].” Dtsch Tierarztl Wochenschr 112(1): 10-16. [crossref]
  61. Knutti B, Kรผpfer U, Busato A. Reproductive efficiency of cows with endometritis after treatment with intrauterine infusions of prostaglandin injections, or no treatment.
  62. Carleton CL, Threlfall WR, Schwarze RA. 2008. Iodine in milk and serum following intrauteri infusion of Lugolโ€™s solution. Inter J Appl ResVet Med 6: 121-129.
  63. McCaughan CJ, Laurie KW, Martin MC, Hooper MW (1984) Iodine in milk of cows after intrauterine infusion of Lugolโ€™s solution. Aust Vet J 61: 200-2001. [crossref]
  64. Machado VS and Silva TH (2020) Adaptive immunity in the postpartum uterus: Potential use of vaccines to control metritis. Theriogenology 150: 201-209. [crossref]
  65. Meira EBS, Ellington-Lawrence RD, Silva JCC, Higgins CH (2020) Recombinant protein subunit vaccine reduces puerpera metritis incidence an modulates the genital microbiome. J Dairy Sci 103: 7364-7376. [crossref]
  66. Nolte O, Morscher J, Weiss HE, Sonntag HG (2001) Autovaccination of dairy cows to treat postpartum metritis caused by Actinomyces pyogenes. Vaccine 19: 3146-3153. [crossref]
  67. Machado VS, de Souzas Bicalho ML, de Souza Meira EB, et al. (2014) Subcutaneous immunization with inactivated bacterial components and purified protein of E. coli, F. necrophorum, and T. pyogenes prevents puerperal metritis in Holstein dairy cows. Plos One 9: 1-11. [crossref]
  68. Lamas GM (2016) da C Ensaio de vacina de rebanho contra agentes de metrite numa exploraรงรคo bovina leiteira. Unifersidada de Lisboa.
  69. Freick M, Kunze A, Passarge O, Weber J, Geidel S (2017) Metritis vaccination in Holstein heifers using a herd-specific multivalent vaccine- Effect on uterine health and fertility in first lactation. Anim Reprod Sci 184: 160-171. [crossref]
  70. Nagata S. 1989. Gene structure and function of granulocyte colony-stimulating factor. Bioassays. 10: 113-117. [crossref]
  71. Zinicola M, Korzec H, Teixeira AGV, Ganda EK, Bringhenti L, Tomazi A, Gilbert RO, Bicalho (2018) Effect of pegbovigrastim administration on periparturient diseases, milk production, and reproductive performance of Hostein cows. J Dairy Sci 101: 1199-11217. [crossref]
  72. Mitchell GB, Albright BN, Caswell JL (2003) Effect of interleukin-8 and granulocyte colony-stimulating factor on priming and activation of bovine neutrophils. Infect immune 71: 1643-1639. [crossref]
  73. Zinicola M, Batista CP, Bringhenti L, Meira EBS jr, Lima FS, et al. (2019a) Effect of recombinant bovine interleukin-8 (rbIL-8) treatment on health, metabolism and lactation performance in Holstein cattle IV: insulin resistance, dry matter intake, and blood parameters. J Dair Sci. 102: 10340-10359. [crossref]
  74. Zinicola M, Bicahlo MLS, Santin T, Marques EC, Bisinotto RS, et al. (2019b) Effects of recombinant bovine interleukin-i (rbIL-8) treatment on health, metabolism, and lactation performance in Holstein cattle II: postpartum uterine health, ketosis, and milk production. J Dairy Sci 102: 10316-10328. [crossref]
  75. McNeel AK, Reiter BC, Weigel D, Osterstock J, Di Croce FA (2017) Validation of genomic predictions for wellness traits in UH Holstein cows. J Dairy Sci 100: 9115-9124. [crossref]
  76. Lopes F, Rosa G, Pinedo P, Santos JEP, et al. (2020) Genome-enable prediction for health traits using high-density SNP panel in US Holstein cattle. Anim Genet 51: 192-199. [crossref]
  77. Abdul-Hafeez MM, Abdul-Kadder HA, Sayed AM, Shehata SH (2019) Intrauterine honey infusion in Holstein Frisian cows with purulent endometritis. Inter J Complementary and Alternative medicine 12:53-57.

The Effect of Nursing Support on Drug Compliance in Inflammatory Bowel Diseases

DOI: 10.31038/IJNM.2021234

Abstract

Background: The main goal of the treatment of inflammatory bowel disease (IBD) is to achieve complete and permanent remission of the disease. A multidisciplinary team approach is also required to make the remission period long-term. IBD nursing in Turkey, Although these patients have begun a new specialization has been made about the pursuit of drug administration, did not find any work. It is thought that this study will provide a well-organized nursing counseling for IBD patients and support patients in drug management.

Objectives: To examine the effect of nurse support on drug compliance in individuals with inflammatory bowel disease.

Method: After selecting the patients who are suitable for the sampling criteria included in the study, the study group was determined, and the patient information form and drug compliance information assessment form were administered to the individuals in the study group as a pre-test (month 0). The information included in the IBD Medical Education Booklet was given by the nurse twice a month in every 15 days on days suitable for the patients in the study group. One month after the training, the patient drug compliance assessment form was applied to the study group again and the scores of the group were analyzed by the nurse.

Results: The average age of the patients is 41.37 years, 53.3% female, 36.67% secondary school graduate and 66.67% married.
Post-training scores of the patients participating in the study increased. It was determined that the drug compliance of individuals with IBD who received nurse support for all other demographic features, except for patients with a maximum disease duration of 2 years, was high.

Conclusion: In this study, it was observed that nurse support given to individuals with IBD in drug management increased the effectiveness of drug use.

Keywords

Inflammatory bowel disease, Inflammatory bowel disease nursing, Nurse support, Drug compliance

Introduction

Inflammatory Bowel Diseases (IBD) is a disease with chronic remission and exacerbations. IBD usually occurs during adolescence or young adulthood, and the etiology of the disease is still unknown [1,2].

There are two types of inflammatory bowel disease, namely ulcerative colitis (UC), which is the continuous involvement of the colon; and crohn disease (CH), which intermittently replaces any part of the gastrointestinal tract from mouth to anus [1-4]. Ulcerative colitis is a bowel disease that is limited to the rectum and colon, has continuous inflammation in the mucosa and generally presents rectal bleeding symptom [1,2]. CH is the most common disease occurring in the ileo-cecal region and then in the colon. Unlike ulcerative colitis, inflammation of the crohn is intermittent and appears as skipped lesions. Although the symptoms vary depending on the location of the disease, the most common symptom is abdominal pain [1,2]. The main goal in the treatment and maintenance of inflammatory bowel disease is to provide complete and permanent remission of the disease [3,4]. In the selection of pharmacological treatment method to be used for the targeted remission period, factors such as the location, intensity and disease activation time of the inflamed area are considered; the choice of a suitable oral, subcutaneous or parenteral drug is decided by healthcare professionals [2,5]. It is expected that the nurse will be included in this decision [1,6]. Drug groups generally applied in drug treatment; 5-aminosalicylic acid (5-ASA) are glucocorticoids and immunosuppressants [6-8]. With the introduction of biological agents in the last few years, progress has been made in the treatment of IBD and there is a need for more nurse support [6-8]. A multidisciplinary team approach is required to make the remission period, which is the main target of the treatment, long-term and to minimize the discomfort caused by the drug side effects [6-10]. In addition, the absence of a specific etiological factor in inflammatory bowel disease caused the lack of protective treatment methods [10-14]. Therefore, comprehensive management of these patients in the clinic should be provided by IBD nurses [10-14].

Purpose of the Research

The research aims to examine the effect of nurse support on drug compliance in individuals with inflammatory bowel disease.

Material and Methods

Type of the Study

The research is a semi-experimental (single-group pretest-posttest), prospective, relational type research.

Place of the Research

The research was carried out in ฤฐzmir Katip ร‡elebi University Atatรผrk Training and Research Hospital Gastroenterology Unit between 11 September 2017 and 01 January 2018.

Research Universe/Sample

The population of the study was taken between 11 September 2017 and 01 January 2018, individuals with IBH who were hospitalized in ฤฐzmir Katip ร‡elebi University Atatรผrk Training and Research Hospital Gastroenterology Department, and a diagnosis of inflammatory bowel disease admitted to the IBD outpatient clinic at ฤฐzmir Katip ร‡elebi University Atatรผrk Training and Research Hospital formed individuals with IBD. Between the dates specified in this universe, n; 30 individuals with IBD, who comply with the criteria of being included in the study, accessible and volunteering, served as the sample of the study.

Data Collection Tools-Validity and Reliability Information

In this study, a Patient Information Form with IBD, a Drug Compliance Information Assessment Form for patients diagnosed with IBD, and a Pharmaceutical Management Booklet for patients with IBD were prepared by the researcher with the opinion of experts to collect data. 9 questions examining the demographic characteristics of the patient such as age, gender, education level in the IBD information form; there are 5 questions about how long the disease has been present, and periods of exacerbation. There are 10 closed-ended questions in the IBD drug compliance assessment form. The questions in the form were evaluated as correct (1), incorrect/unanswered (0). A raw score of 0-10 was obtained for individuals with IBD and scores were evaluated over 100 for ease of interpretation. The fact that the total score obtained from the drug compliance information assessment form in patients diagnosed with inflammatory bowel disease was high, showed that the person with IBD had a high knowledge of their drugs. This form was applied to patients with IBD twice as pre-test (before training) and post-test (after training) and training efficiency was evaluated.

Inflammatory Bowel Disease Medical Management Information Booklet

In the booklet, there are three main topics: Medical Management of Inflammatory Bowel Disease, Purpose of IBD Medical Treatment, Drugs Used in Treatment (5-ASA agents, Sulfasalazine, Corticosteroids, Immunomodulators, Antibiotics) Elements to be Considered in General Medical Treatment of IBD.

Action/Intervention

Before starting the application, the patients were diagnosed in terms of sociodemographic characteristics and drug compliance information, and the training program was applied after the diagnosis was made (mont 0). The main material used in the training program is the IBD Medical Education Booklet prepared by the researcher in line with the current literature. The information included in the IBD Medical Education Booklet was given by the nurse twice a month in every 15 days on days suitable for the patients in the study group. One month after the training, the patient drug compliance assessment form was applied to the study group again and the scores of the group were analyzed by the nurse. The training was given to the patients in a comfortable, quiet, appropriate light, temperature and furniture arrangement in the outpatient clinic environment, protecting the privacy of the patient. The nurse who teaches is doing a master’s degree and has attended trainings on the subject. The trainings were given using a booklet and a slide show prepared on the subject. During the training, patients were encouraged to ask questions. After the training sessions, noncompliance with patients who did not comply was discussed and individual goals were determined and achievement of targets.

Evaluation of the Data

SPSS (Statistical Package for the Social Sciences) 23 program was used to evaluate the findings obtained in the study. While evaluating the study data, Wilcoxon signed rank test was used as a nonparametric statistical test since it does not show normal distribution for demographic properties. Median, one of the descriptive statistical methods, was used while evaluating the study data. Descriptive characteristics of individuals with IBD included in the study were calculated as a percentage. Drug information score averages of patients with IBD were evaluated with pre-test, post-test, appropriate analysis.

Results

Thirty patients treated at our center between 11 September 2017 and 01 January 2018 were included in the study. The characteristics of the patients who received training within the scope of the study are shown in Table 1. The average age of the patients is 41.37 years, 53.3% female, 36.67% secondary school graduate and 66.67% married. 90% of the patients stated that they experienced changes in their normal life due to the disease.

Table 1: Sociodemographic Characteristics of the Participants.

ย 

n

%

Gender Female

14

46.67

Male

16

53.33

Total

30

100

Marital Status Married

20

66.67

Single

9

30

Divorced

1

3,33

Total

30

100

Educational Status Literature

1

3,33

Primary Education

8

26,67

Secondary education

11

36,67

High education

10

33,33

Total

30

100

Work Status Working

16

53.33

Not working

14

46.67

Total

30

100

Economic Situation Over Income Expense

1

3,33

Income and Expense Equal

21

70,00

Income Less Than Expense

8

26,67

Total

30

100

There is Social Security Yes

26

86.67

No

4

13.33

Total

30

100

Has your normal life changed due to your illness? Yes

27

90

No

3

10

Total

30

100

According to the data obtained from Table 2, the ages of individuals with IBD participating in the study vary between 23 and 60 and the average age is 41.37.

Table 2: Questions marked with multiple answers about the disease.

N

Minimum Maximum Mean

Std. Deviation

Age

30

23 60 41,37

11,226

According to Table 3, patients are among the changes due to the disease; it is most disturbed by changes in the excretory habit. And in the vast majority of patients, working life has changed.

Table 3: Descriptive Statistics of the Age Variable.

ย 

n

%

Which of the changes caused by the disease bothers you the most? Changes in eating and drinking habits

10

20.83

Changes in daily activities

11

22.92

Changes in excretion

22

45.83

Changes to your skin

4

8.34

Changes in sexual functions

1

2.08

Which or which changes occurred? In family relationships

9

22.22

In working life

9

33.33

In interpersonal relations

4

14.82

All

8

29.63

According to Table 4, the lowest score in the first test is 10, while the highest score is 80. In the last test, it can be seen that the scores received vary between 40 and 100. In addition, although the average of the scores obtained in the pre-test was 49.67, the average of the scores from the post-test was 72.67. This result shows that nurse support increases the effect of drug compliance.

Table 4: Investigation of Drug Compliance Knowledge Level in Individuals Diagnosed with Inflammatory Bowel Disease (pre-test-post-test).

N

Minimum Maximum Mean

P

Total score (pre-test)

30

10 80 49.67

.071*

Total score (post-test)

30

40 100 72.67

0.128*

Total score (first test) – Total score (post test) analysis ย 

.000**

*One-sample kolmogorov-smirnov test was used. ** Paired samples test was used.

IBD nurse met with patients twice to provide training. It was observed that IBD patients who received nurse support for all demographic characteristics, except for patients with a maximum duration of 2 years, had a high effect on drug compliance (Table 5).

Table 5: First Test And Post Test Point Analysis Showing The Difference Between Sociodemographic Features And Drug Compliance.

Sociodemographic Features

Total Score (Post-Test)

Total Score (Pre-Test) (p)

Gender Female

.002*

Male

.003*

Marital status Married

.000*

Single

.012*

Education Status Primary School Graduate

.024*

Secondary Education Graduate

.006*

Higher Education Graduate

.011*

Economic Situation Income Equivalent to Expenses

.001*

Revenues Less Then Expenses

.016*

Disease Duration

Maximum 2 Years

.223*

3-5 Years

.039*

6-10 Years

.027*

More than 11 years

.004*

Are there any people who get support because of your illness? Yes

.004*

No

.001*

*Wilcoxon marked rank test was used.

Discussion

When we evaluated the data in our study, we found that the pre-education means scores of the individuals with IBD who participated in the study were x = 49.67 after the education mean x = 72.67 (Table 4). Similarly, Nurit et al. (2009) found that patients who received training on their treatment showed higher compliance with the treatment after training [15]. The reason for the increase in the mean scores after the training, which we found in our study, may be the individual trainings planned with the prepared training booklet, videos, and slideshows after the patients have been correctly diagnosed. In some studies, it was found that compliance with treatment was higher in elderly patients than in younger patients [16,17]. This may be due to the increased use of medication due to older patients having more chronic diseases. However, in our study, we did not find a significant difference between treatment compliance and age (Table 4). 73.3% of individuals with IBD who participated in our study stated that they were most disturbed by the changes in the excretory habit due to the changes caused by the disease (Table 2). According to the data of N-ECCO (Nurse-European Crohn Colitis Association) (2013), it was stated that patients complain of the most intestinal control problems during hospitalization. It was determined that drug compliance of individuals with IBD who received nurse support for all other demographic features, except patients with a maximum disease duration of 2 years, was high. In patients with a maximum duration of 2 years, the effect of nurse support on drug compliance was found to be low. This result shows us that in patients newly diagnosed with IBD, nurse support is not effective on drug compliance. Similarly, Erci et al. (2018) found that in their study on hypertensive patients, compliance was lower in patients who had been diagnosed with hypertension for a year or less [18-20]. Based on these data, we comment on the process of accepting the disease of individuals who are new to chronic diseases and changing the behavior after getting the diagnosis of the disease.

Conclusion

In this study, it was observed that nurse support given to individuals with IBD in drug management increased the effectiveness of drug use.

Disclosure

There is no conflict of interest among the authors. In addition, our responsible company comes out with any company in the research.

Ethical Aspect of the Research

In order to conduct the research, the permission of the University’s non-interventional research ethics board numbered E1700080677 and numbered 23.11 of 01.11.2017 was obtained. Written and verbal consents of the patients who agreed to participate in the study were obtained. Research and publication ethics were followed at all stages of the article.

Information

Research idea, design, literature review, data analysis and review EรœA and DA; data collection was carried out by DA. No support was received from any project or firm related to the research. The budget of the research was covered by the researchers. There is no conflict of interest among the authors.

References

  1. M O’Connor, P Bager, Duncan J, Gaarenstroom J, Younge L, et al. (2013) N-ECCO Consensus statements on the European nursing roles in caring for patients with Crohn’s disease or ulcerative colitis. JCC 7: 744-764. [crossref]
  2. Molodecky NA, Soon IS, Rabi DM, Ghali AW, Ferris M, et al. (2012) Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review. Gastroenterology 142: 46-54. [crossref]
  3. Mowat C, Cole A, Windsor A, Ahmad T, Arnott I, et al. (2011) IBD Section of the British Society of Gastroenterology. Guidelines for the management of inflammatory bowel disease in adults. Gut 60: 571-607.
  4. Friedman SL, Mcquaid KR, Greendell JH. (eds) (2007) Current Diagnosis & Treatment in Gastroenterology. ร‡ev.Eds: Sivri B, Gรถnen ร–. Current. Gastroenterology Diagnosis and Treatment. Oncu Printing, ฤฐstanbul pg: 108-129.
  5. Pithadia AB, Jain S (2011) Treatment of inflammatory bowel disease (IBD). Pharmacol Rep 63: 629-642.
  6. Levine JS, Burakoff R (2011) Extraintestinal manifestations of inflammatory bowel disease. Gastroenterol Hepatol 7: 235-241. [crossref]
  7. Golik M, Kurek M, Poteralska A, Bieniek E, Marynka A, et al. (2014) Working Group Guidelines on the nursing roles in caring for patients with Crohn’s disease and ulcerative colitis in Poland. Prz Gastroenterol 9: 179-193. [crossref]
  8. Ozgursoy Uran B, Yฤฑldฤฑrฤฑm Y (2016) A New specialty: inflammatory bowel disease nursing. ฤฐKร‡รœSBFD. 1: 27-33.
  9. Green C, Elliott L, Beaudoin C, Bernstein CN (2006) A population-based ecologic study of inflammatory bowel disease: searching for etiologic clues. Am J Epidemiol 164: 615-628. [crossref]
  10. Konduk BT, Gulsen MT (2017)When to start immunosuppressive therapy in inflammatory bowel diseases?. Current gastroenterology 21: 317-327. [crossref]
  11. Stretton JG, Currie BK, Chauhan UK (2014) Inflammatory bowel disease nurses in Canada: an examination of Canadian gastroenterology nurses and their role in inflammatory bowel disease care. Can J Gastroenterol Hepatol 28: 89-93. [crossref]
  12. Bernstein CN, Eliakim A, Fedail S, Fried M, Gearry R, et al. (2016) World Gastroenterology Organisation Global Guidelines Inflammatory Bowel Disease: Update August 2015. J Clin Gastroenterol 50: 803-818. [crossref]
  13. Faust AH, Halpern LF, Danoff-Burg S, Cross RK (2012) Psychosocial factors contributing to inflammatory bowel disease activity and health-related quality of life. Gastroenterol Hepatol 8: 173-181. [crossref]
  14. Leung WK (2015) Optimization of Inflammatory Bowel Disease Cohort Studies in Asia. Intest Res.;13: 208-212. [crossref]
  15. Nurit P, Bella BC, Gila E, Revital Z (2009) Evaluation of a nursing intervention project to promote patient medication education. J Clin Nurs 18: 2530-2536. [crossref]
  16. AltuntaลŸ O, Akฤฑ E, Huri M (2015) A qualitative study on the effect of drug use on quality of life and social participation in chronic diseases. Journal of Occupational Therapy and Rehabilitation 3: 79-86. [crossref]
  17. Gurol Arslan G, EลŸer I. (2005) YaลŸlฤฑlarฤฑn kendi kendine ilaรง kullanฤฑmฤฑna uyumu ve hemลŸirenin rolรผ. . EGEHFD. 21: 147-57.
  18. Yฤฑlmaz F, ร‡olak MY (2018) Evaluation of drug faith and compliance to treatment in elderly individuals with chronic disease. Turkey Clinics J Health Sci 3: 113-121. [crossref]
  19. Gokalp O, MollaoฤŸlu H (2003) Improper drug use. SDU Faculty of Medicine Journal 10:17-20.
  20. Ercฤฑ B, Elฤฑbol M, Akturk U (2018) Investigation of factors affecting hypertension patients’ compliance to treatment and quality of life. FNJN 26: 79-92.

Treatment Planning for Paediatric Exodontia under General Anaesthesia: A Re-Audit

DOI: 10.31038/JDMR.2021424

Abstract

This re-audit of paediatric exodontia under general anaesthetic assessed seventy one patientsโ€™ GA records across three boroughs in the directorate – Bury, Oldham and Rochdale between 02/01/2020 to 17/03/2020. It assessed compliance with Pennine Care local guidelines including:

  • The justification for GA
  • Attendance at a dedicated POA
  • Pre-operative radiographs and their justification
  • Pre-operative restorations
  • Were patients caries free following GA?
  • Were guidelines adhered to when extracting FPMโ€™s including orthodontic considerations?
  • Were first permanent molars balanced/compensated where appropriate?
  • Were all poor prognosis deciduous teeth extracted under GA?
  • Was appropriate consideration given to balancing/compensating extractions?
  • Record keeping standards
  • Were patients appropriately discharged/reviewed?

Results were varied and showed good compliance with some parts of the guidelines such as 70/71 (98.6%) patients having dedicated POA in the re-audit.

The percentage of patients with a dedicated oral health appointment rose from 13.9% (11/79) for Cycle 1 to 38.0% (27/71) for Cycle 2 which is a 24.1% improvement.

The percentage of patients without documented justification for a lack of radiographs dropped from 26.5% (9/34) for Cycle 1 to 9.1% (3/33) for Cycle 2. This shows a 17.4% improvement.

There were improvements in the numbers of patients having appropriate balancing extractions for unilaterally carious deciduous canines: 6/9 (66.7%) for Cycle 1 and 11/13 (84.6%) for Cycle 2. This shows an improvement of 17.9%

24/26 of patients (92.3%) in Cycle 2 who had planned extraction of FPMโ€™s had pre-operative x-rays and there were some improvements in the number of patients with documented orthodontic considerations compared to Cycle 1. For example:

The number of patients with documented assessment of crowding rose from 16.7% (4/24) in Cycle 1 to 85.2% (23/27) in Cycle 2. This is a 71.8% improvement.

The percentage of patients who were advised of the risk of future mesial tipping or malocclusion of the second permanent molars rose from 8.3% (2/24) in C1 to 57.7% (15/26) in C2. This is a 49.4% improvement.

94.3% (67/71) of patients were caries free following completion of GA in the re-audit whereas the target is 100%. However, some of these findings appear to be record keeping errors.

Greater consistency is needed regarding record keeping as well as the post-operative review/discharge process. A greater awareness of the guidelines would be helpful.

Introduction

The prevalence of dental decay amongst children is high in England and especially so in the North West.

The Community Dental Services under Pennine Care NHS Foundation Trust (now Bridgewater Community Healthcare NHS Foundation Trust) receive a high number of referrals for paediatric exodontia each year. This treatment under GA is not only costly, but there are ever increasing waiting lists [1-4].

Aim/Objectives

Aims

This re-audit retrospectively evaluated the pre-operative planning process for Paediatric exodontia under GA and the post-operative outcomes against Pennine Care local guidelines.

Objectives

  • Evaluate current practice for treatment planning paediatric patients for exodontia under general anaesthesia and compare this to local guidelines.
  • Determine whether the treatment carried out under GA followed the pre-operative treatment plan.
  • Identify improvements that have been made since the previous audit, and define further areas for change.

Criteria and Standards

The guidelines measured in this Audit are based on local guidelines published on Pennine Care Trust Intranet. These local guidelines were in turn drawn from published national guidelines from the Royal College of Surgeons, British Society of Paediatric Dentistry and a consultant opinion group from the Community Dental Service Section of the BDA. The local guidelines are included in the appendix section of this proposal; these guidelines were published in 2016.

For simplicity and the purpose of this audit we assessed compliance with the local guidelines using the following summarised points:

  1. Was there clear justification for extractions under GA?
  2. Did patients attend a dedicated pre-operative assessment?
  3. Were appropriate radiographs taken and justified if not taken?
  4. Were restorations carried out on teeth prior to GA if to be retained?
  5. Were all poor prognosis deciduous teeth planned for extraction?
  6. Was consideration given to deciduous balancing/compensating extractions? E.g. balancing canines to avoid centre line shift or balancing primary first molars in the absence of spacing?
  7. Was a diagnostic OPG x-ray taken for FPM extraction?
  8. Was an orthodontic assessment carried out for FPM extraction?
  9. Was the patient referred for an orthodontic opinion if indicated? E.g. cases with hypodontia, marked skeletal discrepancy and labial/buccal segment crowding
  10. Were poor prognosis FPMโ€™s extracted at the optimum time?
  11. Was the risk of tipping of the second permanent molars discussed where FPMโ€™s were planned for extraction?
  12. Were FPMโ€™s balanced/compensated?
  13. Did the treatment plan at the pre-operative assessment match the treatment carried out at GA?
  14. Was the patient free of decay following completion of the GA?
  15. Were patients appropriately discharged following GA and/or reviewed appropriately?

Standards

  1. All patients should have a dedicated pre-operative assessment prior to the GA appointment and there should be justification for GA documented in the notes.
  2. If radiographs are not taken pre-operatively for deciduous extractions, there should be documented justification for this in all cases in the clinical notes.
  3. Should a deciduous carious canine require extraction, balancing extraction of the contralateral deciduous canine should be discussed with parents/guardian for preservation of the centre line.
  4. Diagnostic OPG should be carried out for all patients undergoing:
  5. a. Timed elective extractions of poor prognosis first permanent molars to encourage mesial drift of the second permanent molar.

    b. Balancing/compensative extractions of first permanent molars.

  6. An assessment of incisal classification and crowding should be carried out for all patients undergoing elective timed extractions of PFMโ€™s and balancing/compensative extractions of PFMโ€™s to determine whether orthodontic referral is appropriate.
  7. Restorations should be completed for any carious teeth that are planned for retention by the end of the GA session.
  8. All paediatric patients should be caries free by the completion of the GA session.

Methodology

Population

This re-audit assessed patientsโ€™ records across three boroughs in the Dental Directorate: Bury Oldham and Rochdale boroughs.

The patients had their dental procedures at either Royal Bolton Hospital or Alder Hey Childrenโ€™s Hospital under General Anaesthesia.

Inclusion criteria: Paediatric patients (under 16 years) both routine and special care requiring exodontia under GA.

Exclusion criteria: any patients over the age of 16 and patients who do not require GA.

Sample Size/Sampling

This audit included an anonymised sample of patients from each of our different boroughs and only included patients for routine exodontia under GA treated at either hospital.

Cycle 1 assessed 79 records with GA dates ranging from 01/06/2017 to 28/07/2017.

Cycle 2 assessed 71 patients with GA dates ranging from 02/01/2020 to 17/03/2020.

Data Collection

Data was collected retrospectively by I Zaman from the R4 computerised dental clinical records system and the operation notes from the GA appointments which are uploaded onto the R4 software.

A copy of the data collection spreadsheet is included in the appendix.

From this data, we intended to determine the following:

  1. Was there general uniformity in the treatment planning for GA exodontia across the different Boroughs in the Directorate?
  2. Were the treatment plans from the pre-operative assessment in line with the local guidelines?
  3. Was there any discrepancy between the treatment prescribed and the treatment carried out under GA and does this conform to standards?
  4. Is there need for further training/development to consolidate treatment planning for paediatric exodontia under GA and to promote greater compliance with guidance across the Directorate?

Data Analysis

The data was analysed on an Excel spreadsheet by I Zaman.

Data Validity

A sizeable sample of 71 patients was analysed for this audit which is comparable to the first cycle and also helped to ensure validity and consistency of data collection and analysis.

Results

Patient Demographics and Pre-operative Assessments

  • Sample = 71 patients
  • The average age of patients was 7.1 years
  • 39 patients were male, 32 were female
  • The sample included 9 special care patients
  • 6% (70/71) of patients had a dedicated pre-operative assessment (POA). One patients POA was combined with their dental check-up.
  • 0% (27/71) of patients had a dedicated oral health appointment.

Justification for Treatment under GA

The justification for GA at the pre-operative assessment is displayed in Figure 1 below. Multi-quadrant decay was the most frequent justification and three patients had no justification documented. The โ€œotherโ€ justifications documented were for 2 patients were โ€œrepeated painโ€ and โ€œdecayed teethโ€.

fig 1

Figure 1: Justifications for GA as percentages.

Pre-operative Radiographs

Figure 2 below shows the distribution of pre-operative radiographs for patients having deciduous tooth extractions (Table 1).

fig 2

Figure 2: : The distribution of pre-operative radiographs for patients having deciduous tooth extractions.

Table 1: Justifications for unavailability of pre-operative radiographs for patients undergoing deciduous extractions.

Lack of radiographs deciduous extractions – justifications

No. of patients

Lack of co-operation

16 (48.5%)

Attempted – patient could not tolerate

3 (9.1%)

All deciduous molars clinically carious

11 (33.3%)

No documented justification for not taking x-rays

3 (9.1%)

Total number of patients

33

For two patients the notes stated that x-rays were not needed. However, not all the deciduous molars were clinically carious or planned for extraction. Therefore this was not a valid justification.

Patients Undergoing Extraction of Permanent Teeth

2 patients mentioned in Table 2 below were originally planned for primary extractions only but ended up undergoing extraction of permanent molars at GA as they were found to be carious. These 2 patients had no pre-operative radiographs as the permanent molars were added to the plan at GA where there was no x-ray facility for routine exodontia. 100% of patients otherwise had pre-operative radiographs. The distribution of radiographs taken is displayed in Table 2 below (Figure 3).

fig 3

Figure 3: The pre-operative orthodontic assessments that were done before GA.
Percentage of patients with orthodontic assessment prior to extraction of first permanent molars.

Table 2: Distribution of radiographs taken for patients undergoing permanent dental extractions.

Radiographs for permanent extractions

No. of patients

OPG

23 (88.5%)

Per-apical

1 (3.8%)

Bitewing

8 (30.8%)

No Radiographs due to unexpected change in GA plan

2 (7.7%)

Total number of patients

26

Balancing Extractions of Deciduous Canines

13 patients presented with unilateral decay in a deciduous canine, and balancing extraction was carried out in 11 of these cases. Distribution is displayed in Table 3 below

Table 3: Distribution of balancing extractions carried out on deciduous canines.

Deciduous canine balancing extractions

No. of patients

Planned balancing extractions of C’s

11 (84.6%)

Balancing extractions discussed – declined by parents

0

Balancing extractions not carried out – no documentation on justification

2 (15.4%)

Total number of patients with unilateral decay in deciduous canine

13

Balancing Extractions of First Primary Molars

For this re-audit an additional parameter was added. It assessed if unilaterally carious first primary molars (Dโ€™s) were balanced in the absence of spacing as per Royal College of Surgeons guidelines3.

1/14 patients with unilateral decay of a โ€œDโ€ had documented assessment of spacing and was spared a balancing extraction (Table 4).

Table 4: Distribution of balancing extractions carried out for first primary molars.

First primary molars balancing extractions

No. of patients

Spacing assessment carried out

1 (7.1%)

Balancing extractions discussed – declined by parents

0

Balancing extractions carried out

0

Balancing extractions not carried out – no documentation on justification

13 (92.9%)

Total number of patients with unilateral decay in first primary molar

14

Extraction of Poor Prognosis First Permanent Molars (FPM)

  • 26/71 patients in this audit underwent extraction of one or more poor prognosis FPMโ€™s.
  • 12 of these patients underwent planned/timed extraction of FPMโ€™s to encourage the mesial migration of the second permanent molar for space closure.
  • 23/26 (88.5%) had a pre-operative OPG to assess dental development. 2 patients had their permanent molars added to the extraction plan at GA where there is no intra-operative x-ray facility.
  • The percentage of patients who had the future risk of 7โ€™s tipping mesially or future risk of malocclusion discussed rose from 8.3% (2/24) in Cycle 1 to 57.7% (15/26) in Cycle 2.
  • A noticeable improvement can be seen especially in the percentage of patients having a crowding assessment. However, the percentage of patients with a skeletal assessment decreased.

Restoration of Teeth

  • 1 special care patient had planned restoration of first permanent molars during GA in this audit.
  • 7/71 patients had enough compliance for permanent restorations prior to GA.
  • The remaining 63/71 patients in this audit were planned for extraction of all decayed teeth.

Differences between Initial Exam and GA Pre-operative Assessment

  • Figure 4 below shows the differences between the initial exam and POA:
  • For 67.6% (48/71) of patients there was no difference between the plan at the exam and POA.
  • 5% (16/71) of patients had additional deciduous teeth added to the extraction plan.
  • For 1 patient a carious deciduous tooth was not included in the plan.
  • 2 patients had a change in the plan with no documented justification for the change.

fig 4

Figure 4: Distribution of the differences between the initial exam and the pre-operative assessment (number of patients out of 71)

Differences between the Pre-operative Assessment Plan and GA

Figure 5 below shows the differences between the POA and GA:

fig 5

Figure 5: Distribution of the differences between the pre-operative assessment and treatment carried out at GA (number of patients out of 71).

  • 7% (41/71) patients had the same treatment at GA as the POA
  • 7% (5/71) patients had fewer teeth extracted due to signs of very early decay or natural exfoliation
  • Additional deciduous extractions were carried out under GA in 26.8 (19/71) patients.
  • 1/71 patient had a change in the plan without documentation.
  • The previous issue in cycle 1 of notes not being available has resolved as we now scan the op notes onto R4.

Patients Who were Caries Free at the Completion of GA

67/71 patients (94.3%) were caries free following completion of GA. According to the clinical records, four patients (may have) been left with decay as follows:

  1. FPMโ€™s noted as being carious at GA. The patient was then re-booked for these teeth to be restored with preventive resin restorations after GA.
  2. It appears that the GA clinician had charted UR5 as extracted at GA on R4 instead of URE in error. Therefore, on the chart carious URE is still present.
  3. The LLD was documented as carious prior to GA, but was not added to the POA extraction plan and was also not extracted at GA. There was no mention in the operation notes about it and LLD is still charted as carious and present on R4.
  4. URE was charted as a retained root in the R4 records, no mention of it at GA if it is present or missing. It is still charted as present on R4 after the GA.

Post-GA Plan and Review

Justification for CDS Review

3 patients with additional special care needs were discharged following GA. For 1 of these patients the POA stated to review after GA, but the patients was discharged with no additional justification (Table 7).

Table 7: Justifications for why patients were reviewed with CDS rather than being discharged.

Justification for CDS review

No. of patients

Medical factors e.g. special care

6 (50%)

Social factors e.g. looked after child

2 (16.7%)

No general dentist

0

Other (high anxiety, previous XGA, poor attendance, poor compliance with OH, high number of teeth extracted at GA/high dental needs, no justification)

4 (33.3)

Total number of patients

12

Table 7.1: Significance of Improvements and compliance with targets

Improvement

Cycle 2 Compliance

Target

There has been a notable improvement (24.1%) in the number of patients with a dedicated oral health appointment prior to GA. However the percentage of patients in the re-audit (38.0%) is still below the target of 100%.

38.0%

100%

A 17.4% improvement in clinicians documenting justifications for not taking radiographs is positive. There were still 9.1% of patients without a documented justification for no x-rays, whereas there should ideally be 0 patients like this.

9.1%

0%

There was a 7.3% improvement in the number of patients with pre-operative OPG radiographs prior to permanent extractions. The target for this is 100%, so the current compliance of 95.8% is good.

95.8%

100%

There was a 17.9% improvement in the number of patients having a balancing extraction of unilaterally carious deciduous canines. Current compliance of 84.6% is significant and shows positive change, but the target for this is 100% (where justified)

84.6%

100%

All patients (100%) having extraction of a unilaterally carious primary first molar should ideally have an assessment of spacing to inform whether a balancing extraction is required. There was a reduction in compliance of 5.4% in the re-audit (overall 7.1% had an assessment of spacing)

7.1%

100%

The percentage of patients who were advised of the risk of future mesial tipping or malocclusion of the second permanent molars after extraction of FPM improved by 49.4%.

57.7%

100%

The patients who underwent assessment of skeletal classification prior to permanent molar extraction showed a reduction in compliance of 6.7%.

30.8%

100%

Patients who underwent assessment of incisor classification prior to permanent molar extraction improved by 10.9%.

69.2%

100%

Patients who underwent assessment of crowding prior to permanent molar extraction improved by 71.8%.

88.5%

100%

There was a 3.7% improvement in C2 regarding the number of patients with changes to their GA plan without documentation compared to C1.

1.4%

0%

1 patient was reviewed due to decay being present at the end of GA, which then required further restoration appointments.

Several patients with high numbers of teeth extracted at GA were not reviewed, for example, one patient had 18 deciduous extractions and was discharged.

1 patient was scheduled for review after GA in the operation note. No reason was given for why the review was needed. Nothing was ever booked in and the patient is still not discharged.

Conclusion

Pre-Assessment

  • C1 100% (79/79) of patients underwent a dedicated pre-operative treatment planning session. This compared to 98.6% (70/71) for C2 as a patient had the initial assessment combined with the POA.
  • The percentage of patients with a dedicated oral health appointment rose from 13.9% (11/79) for C1 to 38.0% (27/71) for C2 which is a 24.1% improvement.

Justification for GA

  • 1 patient had no documented justification for GA in their records for cycle 1 compared to 2 patients for C2. The target for documented justification of GA is 100%.

Pre-operative Radiographs for Deciduous Extractions

  • C1: 63.0% of patients (34/54) undergoing deciduous dental extractions did not have pre-operative radiographs compared to 64.7% (33/51) for C2.
  • For C1 26.5% (9/34) did not have any documented for reason for radiographs not being taken compared to 9.1% (3/33) for C2. This shows a 17.4% improvement.

Pre-operative Radiographs for Permanent Extractions

  • 100% of patients in C1 and C2 who were due for planned FPM extraction had pre-operative x-rays.
  • 5% (23/26) had the recommended OPG for C1 compared to 95.8% (23/24) for C2. This shows a 7.3% improvement.

Balancing Extractions of Deciduous Canines

  • C1: 9 patients presented with caries unilaterally in a deciduous canine. Balancing extraction of the contralateral deciduous canine was planned and carried out in 6/9 cases (66.7%).
  • C2: 13 patients presented with unilateral decay in a deciduous canine, and balancing extraction was carried out in 11/13 of these cases (84.6%).
  • This shows an improvement of 17.9%

Balancing Extractions of First Primary Molars

  • For C1, 12.5% (2/16) patients had an assessment of deciduous molar spacing compared to 7.1% (1/14) for C2.
  • No patients in C1 or C2 had documented balancing extractions of first primary molars.

First Permanent Molar Extractions

  • The percentage with balancing/compensating extractions was C1 29.2% (7/24) and C2 34.6% (9/26)
  • The percentage of patients who were advised of the risk of future mesial tipping or malocclusion of the second permanent molars rose from 8.3% (2/24) in C1 to 57.7% (15/26) in C2. This is a 49.4% improvement.
  • 16/24 patients underwent timed elective extraction of poor prognosis first permanent molars in C1 compared to 12/26 for C2.
  • The patients who underwent assessment of skeletal classification dropped from 37.5% (9/24) in C1 to 30.8% (8/26) for C2. This is a reduction of 6.7%.
  • Patients who underwent assessment of incisor classification rose from 58.3% (14/24) in C1 to 69.2% (18/26) for C2. This is a 10.9% improvement.
  • Patients who underwent assessment of crowding rose from 16.7% (4/24) in C1 to 88.5% (23/26) for C2. This is a 71.8% improvement (Table 5).

Table 5: Information relating to first permanent molar extractions.

Extraction of poor prognosis first permanent molars

No. of patients

Pre-operative OPG radiograph

23 (88.5%)

Balancing or compensating extractions performed

9 (34.6%)

Balancing or compensating extractions not performed despite meeting criteria

5 (19.2%)

Future risk of 7โ€™s tipping mesially or future malocclusion discussed

15 (57.7%)

Total number of patients that had FPM extraction

26

Differences between Initial Exam and GA Pre-operative Assessment

  • C1 60.0% of patients (45/79) had the same number of teeth planned for extraction in the initial charting compared to the POA, compared to 67.6% (48/71) for C2
  • For both C1 and C2, 1 patient had a carious deciduous tooth noted at the initial exam which was not included in the POA plan.
  • For both C1 and C2, 2 patients had a change in the plan with no documented justification for the change.

Differences between the Pre-operative Assessment Plan and GA

  • C1 70.9% of patients (56/79) had the same number of teeth planned for extraction at the POA compared to GA, compared to 57.7% (41/71) for C2
  • C1 5.1% of patients (4/79) had a change in the GA plan without documentation. This compares to 1.4% (1/71) for C2.

Patient Who were Caries Free at the Completion of GA

  • C1 no patients had outstanding restorative treatment to be carried out by the end of the GA session. C2 one patient had outstanding restorative treatment at the end of GA and subsequently had the upper 6โ€™s restored after GA.
  • C1 78/79 patients (98.7%) were caries free following completion of the GA session. According to the clinical chart, a carious deciduous incisor was still retained following treatment under GA.
  • C2 67/71 patients (94.3%) were caries free following the completion of GA. Some of these patients left with decay at the end of C2 may be attributed to record keeping errors.

Post-GA Plan and Review

  • C2, 3 patients with additional special care needs were discharged following GA. For one of these patients the POA stated to review after GA, but the patients was discharged with no additional justification.
  • Several patients with high numbers of teeth extracted at GA were not reviewed, for example, for C2, 1 patient had 18 deciduous extractions and was discharged (Table 6).

Table 6: Post GA plans for all of the patients.

Post GA discharge/review plan

No. of patients

Discharged as per plan

59 (83.1%)

Reviewed with our service

8 (11.3%)

Pending review

4 (5.6%)

Post GA/review plan not documented and not discharged

0

Total number of patients

71

Significance of Improvements and Compliance with Targets

The most significant improvements have been made with the number of patients advised of the risk of future tipping/malocclusion of the second permanent molars after extraction of FPM (49.4%). Also with the patients who underwent assessment of crowding prior to permanent molar extraction (71.8% improvement).

Discussion and Areas for Improvement

  • There is little consistency with whether patients have a dedicated oral health appointment prior to GA. For both cycles the vast majority of patients having these dedicated appointments are from Oldham compared to other boroughs.
  • The justifications recorded for GA arenโ€™t always accurate. For example, some patients were listed as โ€œpre-compliantโ€ when in fact the patients had failed previous treatment attempts under inhalation sedation or local anaesthetic.
  • Listing patients as being โ€œpre-compliant due to ageโ€ seems subjective as each clinician appears to interpret this age limit differently. The same appears to stand for patients listed for โ€œhigh number of extractionsโ€.
  • There also seems to be no consistency with when clinicians try sedation first or when they send the patient for GA directly. This will obviously depend upon the clinicianโ€™s assessment of compliance.
  • Lower than expected numbers of patients with pre-operative radiographs may likely relate to compliance issues based on the justifications for patients listed for GA.
  • In order to comply with guidance it is important for clinicians to justify not taking radiographs correctly rather than statements such as โ€œnot neededโ€ without further explanation. To avoid unnecessary radiographic exposure it is also important for clinicians to be aware of when images are not required such as when all deciduous molars as clinically carious.
  • Early loss of one deciduous canine is highly likely to lead to a centre line shift in the absence of spacing. Therefore it is positive to see an increase in the percentage of patients having appropriate balancing extractions in these cases. However, there appears to be little to no documentation of clinicians assessing first deciduous molars for balancing extractions (which is recommended in guidelines).
  • The findings show that not all patients having extraction of FPMโ€™s are having the recommended pre-operative assessments. However, improvements have been made such as the number of patients having appropriate balancing/compensating extractions and the percentage of patients advised of the risk of future malocclusion or of the second permanent molars tipping mesially. There was also an improvement in the percentage of patients who underwent incisal classification and an assessment of crowding. These improvements will help patients to avoid future orthodontic complications or avoidable orthodontic treatment.
  • There may be a need for an x-ray facility at GA for all cases and not just special care cases. This will be helpful for routine exodontia cases where additional decay is found which may include permanent teeth.
  • Patients should be caries free at the completion of GA. To a certain extent the discrepancies here seem more likely to be record keeping errors.
  • A patient had their lower FPMโ€™s extracted at GA as per advice from their Paediatric Specialist Dentist. The specialist letter didnโ€™t mention compensating extractions so the clinician did not compensate the lower molar extractions with the upper molars or document an assessment of this. It is useful to still document orthodontic assessments in such instances.
  • The issue from Cycle 1 has been overcome whereby records from Alder Hey Childrenโ€™s Hospital were not available locally as we are now scanning the op-note to R4 software post-operatively.
  • Several patients with high numbers of teeth extracted at GA or high needs were not reviewed, while others were. We may benefit from a set protocol to improve consistency with this.
  • It may also be beneficial to have a more robust follow-up system after GA. For example, a patient was planned for review after GA in their operation note. A recall was not set and the patient was still not discharged.
  • A greater awareness of the Paediatric Exodontia guidelines amongst clinicians would be helpful. This should also help with pre-operative assessments and record keeping omissions/errors such as clinicians interchanging the terms โ€œcompensatingโ€ and โ€œbalancingโ€ extractions, when these are in fact separate treatments.
  • The number of patients pending review after GA for cycle 2 is impacted by the Covid-19 pandemic.

Dissemination and Action Plan

This audit highlights certain areas for further improvement. The following recommendations have been made:

  1. Present findings locally to the dental directorate for example local clinical governance/audit meeting and local forums.
  2. Present the findings for the research and clinical audit group meeting for the Trust and other interested parties.
  3. Complete a re-audit when GA services resume subject to the Covid-19 pandemic.
  4. Aim to publish the report in a peer reviewed journal, or a poster/oral presentation at a relevant dental conference as appropriate.

All of the following assume there has been thorough discussion of the risks and benefits of each point with documentation in the clinical notes should be clearly recorded with the reasons why:

  1. If possible, bilateral dental bitewing radiographs are performed prior to the General Anaesthetic; unless caries is well established and frank in all Ds and Es, and all Ds and Es are planned for extraction.
  2. If possible, upper anterior occlusal or periapical radiographs are performed for anterior teeth where there is a history of trauma, or caries into dentine in permanent teeth.
  3. When first permanent molars are to be extracted, a DPT is necessary.
  4. All children must be offered and attend a specific Oral Health appointment, with either a nurse with additional training (Oral Health Certificate) or a Dental Hygienist/Therapist. This is to discuss diet and toothbrushing prior to the GA.
  5. Cs and Ds are balanced for orthodontic purposes (BSPD 2002). In a spaced arch, Ds should not be balance (RCS 2006).
  6. Any deciduous tooth that has a poor long-term prognosis, or has been temporarily dressed with a temporary filling material, such as Glass Ionomer Cement, should be extracted at the GA appointment. Prioritise saving Es when possible for orthodontic benefit, extracting Ds can help maintain Es, as it removes the contact point (Consultant opinion, BDA CDS Group).
  7. Any deciduous tooth with two-surface caries/two-surface restoration, must be extracted at the GA appointment, as they pose a high risk for future problems.
  8. Any tooth that is developmentally close to exfoliation, and has a poor prognosis (two-surface caries/two-surface restoration/pulp treatment/mobile), should be extracted.
  9. Any tooth that is very mobile, should be extracted.
  10. Only strategic teeth (Es) with a very good prognosis, or evidence of missing permanent teeth, could be retained. For example, mildly affected hypoplastic Es with adequate composite sealants/restorations or a well-fitting stainless-steel crown, with radiographic evidence of no pathology; or perhaps in a child with missing second premolars, the Es can be considered to be retained after a GA if they have a good long-term prognosis.
  11. If appropriate, an orthodontic opinion should be sought when considering extracting first permanent molars of poor prognosis.
  12. a. Optimum time approximately 9 years of age.

    b. Where a maxillary first permanent molar is planned to be extracted, do not balance with one from the contralateral side.

    c. Where a mandibular first permanent molar is planned to be extracted, do not balance with one from the contralateral side, but do consider a compensating extraction of the opposing maxillary first permanent molar.

    d. Where both mandibular molars are to be extracted, consider extracting all four first permanent molars.

    e. Where contralateral first permanent molars (e.g. upper right & lower left) are to be extracted, consider extraction of all four first permanent molars.

    f. In the majority of cases of Class I Incisors, if radiographic examination shows the furcations of the mandibular second permanent molars to be developing, and all four second permanent molars are present, and the mandibular first permanent molars are to be extracted, the maxillary first permanent molars should also be extracted (RCS 2004).

  13. Children should not be offered GA for orthodontic extractions.
  14. Any caries in deciduous teeth that is planned to be restored, must be restored prior to the GA appointment, and only if the clinical justification is strong. For example, minimal buccal cavities on maxillary Cs restored with composite or early minimal caries/mildly hypoplastic Es restored with composite or a well-fitting stainless-steel crown.
  15. Any caries in permanent teeth planned to be restored, must be restored before the GA appointment. Co-operation cannot be presumed afterwards. Restorations under GA must be the exception (for children with special needs). When carrying out restorations under GA, consent must be sought for the restoration and for all possible extractions if the tooth has deep caries and a poor prognosis.
  16. The child must be dentally fit after the GA appointment and must not wake up from a dental GA with caries.
  17. Any child posing additional medical/social concern (e.g. no GDP, siblings have had dental GA, low income family, poor attendance, poor compliance with prevention advice, LAC, special needs, high number of teeth removed) should be followed-up within the CDS and guided to find a GDP on an individual basis. The person holding Parental Responsibility. If a guideline is not to be followed.

References

    1. Extraction of Primary Teeth โ€“ Balance and Compensation (2002) British Society of Paediatric Dentistry.
    2. Consultant Opinion โ€œBDA London, CDS Group, March 2015. Dr Mike Harrison, Consultant in Paediatric Dentistryโ€.
    3. A Guideline for first permanent molar extraction in children (2004). Royal College of Surgeons.ย  Williams A, McMullen R.
    4. Extraction of Primary Teeth, Balance and Compensation (2006) by hospi College of Surgeons Faculty Working Party.

C-4 Routes to Methyl Methacrylate: A Sustainable and Environmental Benign Process

DOI: 10.31038/NAMS.2021412

 

The polymerization process using methyl methacrylate (MMA) has been intensively manufactured owing to poly(methyl methacrylate) (PMMA) is a synthetic thermoplastic with high durability, heat resistance, chemical resistance, light transmission, UV resistant, shattering resistance, optical clarity, high scratch resistance, and so forth. Due to these excellent features, PMMA is patented with trademarks, inclusive of Plexiglasยฎ, Acryliteยฎ, Parapetยฎ, Perspexยฎ, Altuglasยฎ, etc. Its incredible role in our daily life is indispensable as we could find PMMA everywhere, such as solar panels, window profiles, lightning, car windows, lights cover, Smartphone screen displays, dental cavity fillings, and so on. Methyl methacrylate (MMA) is the crucial monomer of PMMA, which is also widely used in coatings, paints, adhesives, packaging, sealants, floor polishes, etc. [1]. Despite amid the outbreak of coronavirus in 2019, the market demand of MMA is estimated to grow in coming years. The MMA annual growth rate of a market report has forecasted 3.9% CAGR till 2028 [2] while another report has projected a higher growth rate, 4.3% CAGR, in year 2020-2027 [3]. Apparently, MMA is an ignorable material found in our daily routines, especially in automotive, coatings and paintings. Several industrial processes have been engaged to produce a series precursors of MMA, including methacrolein (MAL) and methacrylic acid (MAA) through ACH process, C-2, C-3, and C-4 methods [4,5]. ACH process is economically attractive but it is restraining from the usage of hazardous HCN reactant and co-production of toxic NH4HSO4. C-2 process generally presents high selectivity but low one-pass conversion, high preparation costs, and low yield caused by MMA hydrolysis to MAA and methanol; C-3 process suffers from limited starting material (propyne) although it gives high yield of MMA through one-step conversion. The aforementioned literature studies are the pros and cons of ACH, C-2, and C-3 processes in the MAL, MAA or MMA production [5].

On the other hand, C-4 hydrocarbons which comprised of isobutane, isobutene, tert-butyl alcohol, methacrolein (MAL) or 2-methyl-1, 3-propanediol, are the byproducts obtained from petroleum refinery process. Thus, these chemicals are considerably high availability and less hazardous compared to the other methods mentioned. The obtained C-4 materials act as the main feedstocks in chemical industry owing to their intermediates and products have high-commercialised values. This process is also more industrialized practical because the feedstock could produce higher yield of MMA with lower capital costs. By valorizing the byproducts from petroleum to value-added intermediates or products, C-4 process is also in line with Sustainable Global Development, Goal No. 12 Responsible Consumption and Production. To further promote the production of MMA, engineering of appropriate structural catalysts should be studied. There are diverse catalysts used to enhance the conversion, selectivity and yield towards MAL, MAA or/and MMA, such as vanadium pyrophosphate [6], CsFeCoBiMnMoOx [7], Pd-Pb/ฮณ-Al2O3 [8], Bi-doped-styrene-divinyl benzene copolymer (SDB) [9], Cu- and Fe-doped CsH3PMo11VO40 [10], NiAu single atom alloys and so forth [11]. Heteropolyacid is revealed as one of the efficient mixed metal oxides in the oxidation of light alkanes due to its dual functionality, i.e. acidity and oxidative properties. The advanced materials, such as layered double hydroxide (LDH), metal-organic framework (MOF), and etc, are potential to be functionalized with metal oxide-based materials to give synergistic effects.

Additionally, a cascade pathway from C-4 to MMA should be advocated too. Since both MAL and MAA are the intermediates to produce the desired MMA, therefore isobutane or isobutene conversion to MAL and MAA are vastly reported. Undeniably, efforts extensively focus on discontinuous processes to MAL or MAA: the oxidative dehydrogenation of isobutane or/and isobutene to MAL [12-15], oxidative dehydrogenation of isobutane to MAA [16,17], and MAL oxidation to MAA [18-23]. In recent years, it is worth noting that the cascade oxidative esterification of MAL to MMA has been investigated [9,11,24,25], nonetheless, on-going studies are still necessary. Directing the discontinuous process to cascade one-step synthetic route is an urge due to the process simplicity and reduced byproducts. This will be prompting energy- and cost-saving with the aim to create a sustainable, eco-friendly environment and economically viable communities.

In short, this research has grown rapidly with possessing great potential in the field of industrial catalysis, which great strides in synthetic transformation process and catalysts engineering. This is making towards environmental cleanliness and sustainable process.

Acknowledgements

The work is supported by Ministry of Higher Education (MOHE) through the Fundamental Research Grant Scheme (FRGS/1/2019/TK02/XMU/03/1), Hengyuan International Sdn. Bhd. (grant number: EENG/0003) and Xiamen University Malaysia Research Fund (grant number: XMUMRF/2019-C4/IENG/0019 and XMUMRF/2020-C5/IENG/0029).

References

  1. Kato Y, Nitta S, Shimazu S, Kurashina M, Katoh M, et al. (2019) Effect of introduction of trace amount of chromium species in improving catalytic performance of MCM-48 in oxidative dehydrogenation of isobutane. Journal of Chemical Engineering of Japan 52: 99-105.
  2. Global market study on methyl methacrylate (MMA) – Increasing application in PMMA production to account for significant revenue generation opportunities (2019).
  3. Methyl methacrylate (MMA) – Global market trajectory & analytics (2021).
  4. Nagai K (2001) New developments in the production of methyl methacrylate. Applied Catalysis A: General 221: 367-377.
  5. Mahboub MJD, Dubois JL, Cavani F, Rostamizadeh M, Patience GS (2018) Catalysis for the synthesis of methacrylic acid and methyl methacrylate. Chemical Society Review 47: 7703-7738.
  6. Guan J, Xu H, Jing S, Wu S, Ma Y, et al. (2008) Selective oxidation of isobutane and isobutene over vanadium phosphorus oxides. Catalysis Communications 10: 276-280.
  7. Peng Z, Yu C, Cai T, Deng Q (2004) Selective oxidation of isobutene over CsFeCoBiMnMoOx mixed oxide catalyst. Journal of Natural Gas Chemistry 13: 172-176.
  8. Diao Y, Yang P, Yan R, Jiang L, Wang L, et al. (2013) Deactivation and regeneration of the supported bimetallic Pdโ€“Pb catalyst in direct oxidative esterification of methacrolein with methanol. Applied Catalysis B: Environmental 142: 329-336.
  9. Wang B, Li H, Zhu J, Sun W, Chen S (2013) Preparation and characterization of mono-/multi-metallic hydrophobic catalysts for the oxidative esterification of methacrolein to methyl methacrylate. Journal of Molecular Catalysis A: Chemical 379: 322-326.
  10. Zhang H, Yan R, Yang L, Diao Y, Wang L (2013) Investigation of Cu- and Fe-doped CsH3PMo11VO40 heteropoly compounds for the selective oxidation of methacrolein to methacrylic acid. Industrial & Engineering Chemistry Research 52: 4484-4490.
  11. Trimpalis A, Giannakakis G, Cao S, Flytzani-Stephanopoulos M (2020) NiAu single atom alloys for the selective oxidation of methacrolein with methanol to methyl methacrylate. Catalysis Today 355: 804-814.
  12. Weber D, Weidler P, Kraushaar-Czarnetzki B (2017) Partial oxidation of isobutane and isobutene to methacrolein over a novel Moโ€“Vโ€“Nb(โ€“Te) mixed oxide catalyst. Topics in Catalysis 60: 1401-1407.
  13. Zhai Z, Wang X, Licht R, Bell AT (2015) Selective oxidation and oxidative dehydrogenation of hydrocarbons on bismuth vanadium molybdenum oxide. Journal of Catalysis 325: 87-100.
  14. Jia MJ, Valenzuela RX, Amorรณs P, Beltrรกn-Porter D, El-Haskouri J, et al. (2004) Direct oxidation of isobutane to methacrolein over V-MCM-41 catalysts. Catalysis Today 91-92: 43-47.
  15. Guan J, Song K, Xu H, Wang Z, Ma Y, et al. (2009) Oxidation of isobutane and isobutene to methacrolein over hydrothermally synthesized Moโ€“Vโ€“Teโ€“O mixed oxide catalysts. Catalysis Communications 10: 528-532.
  16. Jing F, Katryniok B, Dumeignil F, Bordes-Richard E, Paul S (2014) Catalytic selective oxidation of isobutane to methacrylic acid on supported (NH4)3HPMo11VO40 catalysts. Journal of Catalysis 309: 121-135.
  17. Capua AD, Dubois JL, Fournier M (2007) Fine analysis of by-products of the selective oxidation of isobutane into methacrolein and methacrylic acid over Moโ€“Vโ€“P catalyst. Journal of Molecular Catalysis A: Chemical 263: 62-69.
  18. Yasuda S, Iwakura A, Hirata J, Kanno M, Ninomiya W, et al. (2019) Strong Brรธnsted acid-modified chromium oxide as an efficient catalyst for the selective oxidation of methacrolein to methacrylic acid. Catalysis Communications 125: 43-47.
  19. Zhou L, Sun Y, Li B, Zhengjie Li, Zhang Z, et al. (2019) Selective oxidation of methacrolein to methacrylic acid on carbon catalysts. Catalysis Communications 126: 44-49.
  20. Cao YL, Wang L, Xu BH, Zhang SJ (2018) The Chitin/Keggin-type heteropolyacid hybrid microspheres as catalyst for oxidation of methacrolein to methacrylic acid. Chemical Engineering Journal 334: 1657-1667.
  21. Zhou L, Wang L, Diao Y, Yan R, Zhang S (2017) Cesium salts supported heteropoly acid for oxidation of methacrolein to methacrylic acid. Molecular Catalysis 433: 153-161.
  22. Zheng Y, Zhang H, Wang L, Zhang S, Wang S (2016) Transition metal-doped heteropoly catalysts for the selective oxidation of methacrolein to methacrylic acid. Frontiers of Chemical Science and Engineering 10: 139-146.
  23. Zhou L, Wang L, Wang H, Cao Y, Yan R, et al. (2016) Silica supported heteropoly catalysts for oxidation of methacrolein to methacrylic acid. Journal of Thermodynamic and Catalysis 7: 1000176.
  24. Guan Y, Ma H, Chen W, Li M, Qian G, et al. (2020) Methyl methacrylate synthesis: Thermodynamic analysis for oxidative esterification of methacrolein and aldol condensation of methyl acetate. Industrial & Engineering Chemistry Research 59: 17408-17416.
  25. Li H, Tan Y, Chen X, Yang W, Huang C, et al. (2021) Efficient synthesis of methyl methacrylate by one step oxidative esterification over Zn-Al-mixed oxides supported gold nanocatalysts. Catalysts 11: 162.

Safety of Surgical Management of Diverticulitis during the COVID-19 Pandemic

DOI: 10.31038/JIPC.2021121

Abstract

Aim: The impact of the global COVID-19 on colorectal conditions remains unknown. Thus, we aimed to determine the effect of COVID-19 limitations on diverticular disease.

Method: Retrospective analysis of Premier hospital inpatient files from 1/1/2019 through 6/30/2020 for admissions and surgical procedures for patients with diverticular disease. Comparison between first six months of 2019 and 2020 for disease incidence, severity, operative management, and adverse events. Primary outcome measure was pulmonary failure and secondary outcome measures were adverse events, rates of hospitalization and surgical intervention.

Results: Admissions for diverticulitis declined by 25% in 2020 as compared to 2019. The proportion of urgent diverticular disease cases rose significantly in April 2020 to 59.1% from an average of 37.5% in 2019 (p<0.0001). Although diverticular abscess comprised 55.1% of all admissions in 2019, the proportion of abscess cases rose to 69.3% in April 2020. Consequently, 38% of all procedures in the spring of 2020 resulted in a stoma, 29% higher than in 2019. Select postoperative complications including organ space infections and sepsis were significantly higher in April 2020. Most importantly, pneumonia complications were similar in 2019 (1.6%) and 2020 (1.8%) (p=0.5) as were respiratory failure rates (4.2% in both 2019 and 2020).

Conclusions: During the COVID-19 pandemic, there was a notable decreased rate of hospitalization for diverticulitis but an increased disease severity among those admitted. The increase in diverticular abscess procedures coincided with higher rates of organ space infections and ostomy creations but no difference in respiratory complications. These data indicate that surgery for diverticulitis in the setting of the COVID-19 pandemic can be safely performed.

Statement: Limitations incited by the COVID-19 pandemic resulted in decreased hospitalization rates for diverticulitis but increased severity of disease for those admitted, which coincided with increased rates of postoperative organ space infections and ostomy creations. However, respiratory complications remained stable demonstrating continued safety of operative management in this critical time.

Introduction

Coronavirus disease 2019 (COVID-19) is an infectious disease caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Although COVID-19 has a variable clinical course, the virus is associated with severe respiratory, vascular, and/or gastrointestinal symptoms which can progress in severity in highโ€risk individuals.ย In the most common case, COVID-19 is characterized by symptoms of viral pneumonia such as fever, fatigue, and dry cough [1]. The virus is highly contagious as it is spread from person to person through respiratory secretions and/or contaminated fomites. Within short order, Coronavirus spread around the world leading the World Health Organization to declare COVID-19 a pandemic on March 11, 2020 [2].

The COVID-19 pandemic changed many dimensions of health care in the United States and affected the operations of a host of healthcare facilities in 2020 [3]. In surgery, the American College of Surgeons recommended that โ€œeach hospital, health system, and surgeon should thoughtfully review all scheduled elective procedures with a plan to minimize, postpone, or cancel electively scheduled operations, endoscopies, or other invasive procedures until we have passed the predicted inflection point in the exposure graph and can be confident that our health care infrastructure can support a potentially rapid and overwhelming uptick in critical patient care needs.โ€ These recommendations led to reduced numbers of patients in ambulatory clinics, fewer screening and other elective procedures, as well as other interruptions in inpatient services [4,5]. Models of these interruptions in cancer screening and treatment have predicted over 10,000 excess deaths from breast and colorectal cancer over the next decade [6].

Given the limitations and restrictions in surgical care as well as other concerns related to obtaining non COVID-19 related treatment, we undertook a study to determine the impact of COVID-19 on colorectal surgery care in the United States. In particular we sought to evaluate diverticulitis care during the height of the pandemic as well as outcomes from surgery during the height of the pandemic as compared to one year prior. In addition, we evaluated the risk of respiratory complications related to surgery during the COVID-19 pandemic, as well as all other postoperative complications, as compared to one year earlier. These data are of particular importance as other COVID surges occur as well as other potential respiratory epidemics.

Methods

Database

We abstracted records from the Premier hospital inpatient files from 1/1/2019 through 6/30/2020 accounting for 586 hospitals. The Premier Healthcare Database is one of the most comprehensive electronic healthcare databases originating from the merger of Premier with American Healthcare Systems and SunHealth in 1997 [7]. Data derive from a large, U.S. hospital-based, service-level, all-payer capture model that contains information on inpatient discharges, primarily from geographically diverse non-profit, non-governmental and community and teaching hospitals and health systems from rural and urban areas [7]. Hospitals and healthcare systems submit administrative, healthcare utilization and financial data from patient encounters approximating 10 million inpatient visits per year or twenty-five percent of annual United States inpatient admissions. The data are de-identified and HIPAA compliant, thereby considered exempt from Institutional Review Board oversight as dictated by Title 45 Code of Federal Regulations, Part 46 of the United States, specifically 45 CFR 46.101(b).

Cohort

All adult patients with diverticular disease were identified based on the primary diagnosis with ICD-10 codes of K57.20, K57.21, K57.32 or K57.33 for hospitalization. Patient demographics were collected as covariates including race, sex, age, and marital status. Charlson comorbidity score was also calculated and can be calculated as described in previous publications [8]. In addition, the covariates of payer information, hospital regional location, hospital rural urban location, hospital bed size, and teaching status of hospital were also abstracted. Presence of abscess at time of admission was determined based on patients who had ICD-10 diagnosis codes K57.20 or K57.21. Patients were then assigned as either medical or surgical based on having surgical Disease Related Group (DRG) codes and ICD-10 procedure codes (Appendix 1). Minimally invasive procedures were identified with the ICD-10 surgical procedure codes possessing the 5th digit as 3, 4 or 6 while open procedures were identified with the ICD-10 surgical procedure codes possessing the 5th digit as 0. Formation of stoma was identified based on ICD-10 procedure codes listed in appendix 1. Cases were classified as urgent cases by hospital admission type.

Primary Outcome

The outcome of primary interest was respiratory failure defined with hypoxia or hypercapnia during the index hospital stay and identified with ICD-10 diagnostic codes of J80, J96, or J98.1 (Appendix 1).

Secondary Outcomes

Secondary outcomes of interest include pneumonia as recorded by ICD-10 codes (see Appendix 1). Additionally, we recorded adverse events of ileus/small bowel obstruction, peritonitis/organ space infection, superficial surgical site infection, gastrointestinal bleeding, urinary tract infection, myocardial infarction, sepsis, acute renal failure, and hemorrhage complications. A full list of ICD-10 codes is included in appendix 1.

Analysis

Admissions and surgical procedures for patients with diverticular disease were compared for the first six months of 2019 (1/1/2019 through 6/30/2019) as compared to the first six months of 2020 (1/1/2020 through 6/30/2020) during the COVID-19 pandemic. Patient demographics, patient covariates, use of surgery procedures, presence of abscess, and adverse events were compared during the two periods with Chi square analysis for categorical variables. Analysis was performed at the monthly basis for admissions and outcomes. In addition, we compared the development of respiratory complications such as pneumonia or pulmonary failure during the two time periods with the same analysis. Multivariable logistic regression analyses were performed to control for urgent nature of surgery while evaluating postoperative complications. The multivariable analysis only included use of urgent nature of surgery and not additional variables due to the small sample size. All analyses were performed with SAS 9.4 and p value of less than 0.05 was considered significant based on multiple tests of variance.

Results

Cohort

Admissions for diverticulitis for the first six months of 2019 totaled 20,717 patients with 14,408 (69.6%) medical admissions and 6,309 (30.5%) surgical admissions. However, during the first six months of 2020, there were 24.6% fewer total admissions comprising 15,630 total admissions with 10,829 (69.2%) medical admissions and 4,801 (30.7%) surgical admissions. Patient demographics were similar across time periods. There were proportionately more women admitted during each time period. In addition, there were proportionately more patients over age 65 and with Charlson Comorbidity of 0 regardless of time period. Commercial insurers were the most common payer for both time periods and most patients were treated at hospitals with over 500 beds (Table 1).

Table 1: Patient and hospital characteristics.

table 1(1)

table 1(2)

table 1(3)

Chi-square analysis was used to compare difference in each characteristic between the years 2019 and 2020 within each month. All p >0.05, except: *p=0.0114 and 0.0036 in April and May respectively; **p=0.0002 in April; ***p=0.024 in April and ****p=0.0266 in March. All cells less than 10 were marked as โ€œ<10โ€ and their corresponding percentages were not reported (NR). CCI: Charlson Comorbidity Index.

Disease Severity

There were proportionately more patients admitted with diverticular abscess in the first six months of 2020 as compared to the same time period in 2019 (p<0.0001). There were 9,872 patients (47.7%) admitted with diverticular abscess in 2019 as compared to 7,860 patients (50.3%) in 2020 (Table 2).

Table 2: Incidence of diverticular abscess among all hospital admissions.

Year

2019

ย  2020

ย 

ย 
Months

N

% N %

p-value

Jan

1646

48.0 1615 48.4

0.6934

Feb

1537

48.5 1558 49.0

0.6771

Mar

1671

47.3 1330 49.9

0.0416

Apr

1670

47.6 917 54.6

<.0001

May

1715

47.8 1148 51.0

0.0173

Jun

1633

47.0 1292 51.4

0.0008

Total

9872

47.7 7860 50.3

<.0001

The number of urgent surgical cases for diverticular disease was 2,123 for the first six months of 2019 or 33.7% of surgical cases. However, the number of urgent cases in the first six months of 2020 was 1,756 or 36.6% of surgical cases (p<0.001). Comparing individual months of both calendar years, there were proportionately more urgent cases in April 2020 (59.2%) as compared to 36.9% in April 2019 (p<0.0001). There were no other significant differences in urgent surgical cases by month for the other months (Table 3).

Table 3: Urgent Operations by Month.

Year

2019

ย  2020 ย 

ย 

Months

N

% N %

p-value

Jan

360

34.3 336 33.1

0.5805

Feb

322

34.5 326 35.5

0.64

Mar

365

36.2 322 40.6

0.0595

Apr

392

37.5 237 59.1

<.0001

May

360

36.5 285 42.2

0.0182

Jun

324

34.9 250 32.6

0.3245

Total

2123

35.7 1756 38.4

0.0035

Surgery

When surgery was performed in 2019, 55.1% had a diverticular abscess yet 58.6% had an abscess during the same time period in 2020 (p=0.004). In April of 2020, there were substantially more surgical patients with diverticular abscess (69.3%) then in the same time period in 2019 (55.6%) (p<0.0001) (Table 4). In addition, minimally invasive surgical treatment for diverticular disease was slightly less common in 2019 (41.9%) as compared to 2020 (42.8%). The most significant difference in use of minimally invasive procedures occurred in April at which time minimally invasive procedures were used in 43% of all procedures in 2019, yet only 34% of cases in April 2020 (p<0.004) (Table 4).

Table 4: Abscess rate and surgical approach among patients who underwent surgery.

2019 ย  2020 ย  ย 
N % N %

p-value

Abscess

Jan

590 56.1 558 55.0 0.5953
Feb 509 54.5 504 54.9

0.8610

Mar

543 53.9 463 58.3 0.0593
Apr 581 55.6 278 69.3

<.0001

May

551 55.8 400 59.3 0.1647
Jun 509 54.9 447 58.4

0.1475

Total

3283 55.1 2650 58.0

0.0035

MIS

Jan

465 44.2 430 42.4 0.3889
Feb 393 42.1 415 45.2

0.1745

Mar

451 44.7 339 42.7 0.3846
Apr 449 43.0 138 34.4

0.003

May

401 40.6 248 36.7 0.1106
Jun 389 41.9 346 45.2

0.179

Total

2548 42.8 1916 41.9

0.3723

Stoma Creation

Jan

281 26.7 284 28.0

0.5260

Feb

255 27.3 262 28.5 0.5525
Mar 291 28.9 278 35.0

0.0053

Apr

321 30.7 176 43.9 <.0001
May 287 29.1 241 35.7

0.0044

Jun

265 28.6 207 27.0 0.4838
Total 1700 28.6 1448 31.7

0.0005

MIS: Minimally Invasive Surgery.

A stoma was made in 28.6% of all patients who underwent surgery during 2019. Yet in 2020, there was a substantially greater proportion of stomas fashioned (31.7% of all surgical procedures; p=0.0005). In April of 2020, the proportion of patients who received a stoma reached 43.9% which was substantially higher (30.7%) than in April of 2019 (p<0.0001) (Table 4).

Respiratory Adverse Events

Most importantly, pneumonia complications were similar in 2019 (1.7%) as they were in 2020 (1.8%) (p=0.5). There was no difference in pneumonia rates by month across time periods. In addition, respiratory failure rates were similar across time periods, 4.2% in 2019 and 2020, with the only significant difference occurring in April (4.2% in 2019 vs 6.8% in 2020). Rates of respiratory failure were higher in patients who had urgent surgery and no different even in April of 2020 (10.1%) as compared to April 2019 (7.9%) (p=0.4) (Table 6).

Table 6: Postoperative respiratory adverse events.

Year

2019

ย  2020 ย 

ย 

Month

N

% N %

p-value

Pneumonia
Jan

15

1.4 23 2.2

0.156

Feb

20

2.2 20 2.2

0.9559

Mar

22

2.2 18 2.2

0.9038

Apr

14

1.4 <10 NR

0.8896

May

15

1.6 <10 NR

0.7544

Jun

12

1.2 <10 NR

0.6371

Total

98

1.7 83 1.8

0.5053

Pulmonary failure
Jan

51

4.8 45 4.4

0.651

Feb

36

3.8 44 4.8

0.3205

Mar

37

3.6 29 3.6

0.9837

Apr

43

4.2 27 6.8

0.0378

May

37

3.8 19 2.8

0.3001

Jun

44

4.8 28 3.6

0.2701

Total

248

4.2 192 4.2

0.9266

All cells less than 10 were marked as โ€œ<10โ€ and their corresponding percentages were not reported (NR).

Adverse Events

There was no difference in the rates of the majority of postoperative complications including superficial surgical site infection, gastrointestinal bleeding, hemorrhage, or urinary tract infection. However, other postoperative complications such as sepsis were significantly higher (6.8%) in April 2020 as compared to the same time period 1 year earlier (3.4%; p<0.005) (Table 5). Similarly, there were statistically significant increases in the rates of postoperative peritonitis or organ space infection as well as ileus/small bowel obstruction in the month of April 2020 compared to April 2019. However, when controlling for the urgent nature of the operation, the rate of all postoperative complications including sepsis became statistically equivalent between the 2019 and 2020 time periods except for organ space infection (OR=1.20 95% CI:1.10-1.31; p<0.001).

Table 5: Post-operative adverse events.

2019 ย  2020 ย  ย 
N % N %

p-value

Ileus/ Small Bowel Obstruction (included constipation and PONV)
Jan 161 15.4 149 14.6 0.6843
Feb 126 13.4 125 13.6

0.9368

Mar 132 13.0 113 14.2

0.4847

Apr 146 14.0 75 18.8

0.0252

May 134 13.6 119 17.6 0.0239
Jun 133 14.4 109 14.2

0.9523

Total

832 14.0 690 15.1

0.1037

Peritonitis/Organ space SSI

Jan

234 22.2 264 26.0 0.0466
Feb 196 21.0 262 28.6

0.0002

Mar

272 27.0 231 29.0 0.3217
Apr 260 24.8 131 32.6

0.0028

May

271 27.4 211 31.2 0.0934
Jun 231 24.8 205 26.0

0.3809

Total

1464 24.6 1304 28.5

<0.0001

Superficial SSI and wound complications (Hematoma/ Seroma, Wound Infection, Wound Dehiscence)

Jan

26 2.4 19 1.8 0.3488
Feb 22 2.4 21 2.2

0.9227

Mar

22 2.2 19 2.4 0.7662
Apr 31 3.0 16 4.0

0.3258

May

23 2.4 20 3.0 0.4249
Jun 14 1.6 15 2.0

0.4777

Total

138 2.3 110 2.4

0.7645

GI bleeding

Jan

66 6.2 63 6.2 0.9455
Feb 54 5.8 48 5.2

0.6021

Mar

59 5.8 47 6.0 0.9527
Apr 58 5.6 24 6.0

0.7489

May

54 5.4 48 7.2 0.1713
Jun 50 5.4 42 5.4

0.9315

Total

341 5.7 272 6.0

0.6253

Urinary tract infection/Retention of urine

Jan

90 8.6 63 6.2 0.0409
Feb 61 6.6 54 5.8

0.563

Mar

63 6.2 49 6.2 0.9452
Apr 70 6.6 38 9.4

0.0721

May

62 6.2 42 6.2 0.9608
Jun 55 6.0 52 6.8

0.468

Total

401 6.7 298 6.5

0.6624

MI/Cardio complication

Jan

46 4.4 53 5.2 0.3687
Feb 40 4.2 45 5.0

0.5243

Mar

51 5.0 38 4.8 0.7901
Apr 45 4.4 31 7.8

0.009

May

65 6.6 35 5.2 0.2384
Jun 33 3.6 43 5.6

0.0417

Total

280 4.7 245 5.4

0.124

Sepsis

Jan

25 2.4 37 3.6 0.0916
Feb 30 3.2 24 2.6

0.4447

Mar

31 3.0 32 4.0 0.2733
Apr 35 3.4 27 6.8

0.0045

May

23 2.4 14 2.0 0.7281
Jun 35 3.8 21 2.8

0.2379

Total

179 3.0 155 3.4

0.2635

Dehydration/ Acute renal failure

Jan

131 12.4 127 12.6 0.9737
Feb 111 11.8 104 11.4

0.7091

Mar

123 12.2 108 13.6 0.3776
Apr 122 11.6 60 15.0

0.0915

May

105 10.6 96 14.2 0.0278
Jun 102 11.0 79 10.4

0.653

Total

694 11.7 574 12.6

0.1576

Hemorrhage

Jan

41 4.0 38 3.8 0.8522
Feb 39 4.2 42 4.6

0.6742

Mar

36 3.6 33 4.2 0.5208
Apr 45 4.4 15 3.8

0.6293

May

29 3.0 29 4.2 0.1384
Jun 29 3.2 33 4.4

0.1968

Total

219 3.7 190 4.2

0.2071

Mortality

In hospital mortality occurred rarely in patients treated for diverticulitis. The proportion of patients who experienced an inpatient mortality was 0.7% in both time periods (Table 1).

Discussion

Data from these analyses reveal a substantial decline in the number of inpatients with diverticulitis during the height of the COVID-19 pandemic or the first two quarters of 2020 as compared to the same time period in 2019. Despite the net decline in diverticulitis admissions, the proportion of cases deemed urgent rose significantly during COVID-19. In addition, there was a marked reduction in the proportion of patients who had minimally invasive surgery during the COVID surge in early 2020. These changes were associated with a temporal increase in sepsis and deep organ space complications in April of 2020. However, this observed increase in postoperative complications during the COVID-19 period became statistically insignificant when accounting for the emergent nature of the operations, with the exception of organ space infection likely secondary to the higher rate of preoperative abscesses. Of great importance, despite high numbers of COVID-19 hospitalizations during the height of the pandemic, there was no increase in respiratory complications. These results indicate that surgery for diverticulitis (both urgent and elective) can be safely performed without any additional increase in respiratory consequences or mortality.

Across the board, many patients with non-respiratory health conditions delayed or avoided care during the height of the COVID-19 pandemic. A number of studies demonstrated reduced emergency room visits across the United States and United Kingdom during the height of the COVID-19 pandemic, including fewer evaluations for acute coronary syndromes and strokes [9-17]. Similarly, our data confirm fewer admissions for diverticular disease as total numbers declined by 25 percent during the height of the pandemic. In addition, among the patients who were admitted for diverticular disease, proportionately more patients were admitted with much more severe disease (i.e. abscess) leading to far greater rates of stoma creation as compared to one year prior.

There are a number of possible explanations for the decline in numbers of diverticulitis admissions during the height of the COVID-19 pandemic. Although lifestyle changes during this time may be one explanation, it is more likely that many patients simply deferred evaluation because of anxiety related to management during the pandemic. In a survey of adult respondents, 40.9% reported having delayed or avoided any medical care, including urgent or emergency care (12.0%) and routine care (31.5%), because of concerns about COVID-19 [18]. Avoidance of routine care was particularly common among unpaid caregivers who sought to avoid potential virus risk for many reasons. Data do reveal that it is difficult for patients to anticipate when emergency department evaluation is necessary [19]. As with other studies our data similarly raise concerns about patients deferring care and presenting to the emergency department when diverticulitis progressed to more complicated forms [20].

In addition to patient avoidance of routine care, many healthcare services underwent paradigm shifts in order to more safely deliver care while reducing potential points of transmission. Elective procedures were prohibited leading to sharp declines across the board for many orthopedic conditions as we also noted with diverticular disease. Delays in surgery are likely to have real impact on patient health outcomes, hospital finances and resources, as well as training and research programs [21]. Delays in surgery have been shown to result in higher rates of surgical site infections, leading to increased costs ranging from $7000 to $17,000 for coronary artery bypass graft and colon and lung resections [22]. It is unclear what the costs of delay in care may be for patients with diverticulitis, but an increase in septic complications was noted during the height of the COVID-19 pandemic.

To promote safe surgery many surgical societies as well as Intercollegiate guidelines from the United Kingdom advocated for non-operative management of many surgical conditions and avoidance of laparoscopy when surgery is unavoidable [23]. The effects of these guidelines on appendicitis treatment in the United Kingdom was associated with many practice changes during the pandemic [20]. Early concerns were also raised involving the risk of aerosolization with minimally invasive surgery in the operating room. Many hospitals began to screen patients for the virus before any scheduled surgery and when not possible, personal protective equipment to decrease susceptibility to aerosol diffusion was advised. As expected, we identified a reduction in the rate of laparoscopic treatment during the pandemic which may have been related to the suggested guidelines. It is, however, highly likely that the changes we noted in use of laparoscopy may have been related to more severe diverticular disease.

Interestingly, in the previously described appendicitis study (English et al.), the investigators did not notice an increase in short-term complications nor any detriment in length of stay related to appendicitis treatment during COVID [20]. Our data, however, revealed a significant change in septic complications during the height of the COVID-19 pandemic following surgery for diverticular disease. In addition, there were substantial concerns of pulmonary complications related to surgical treatment. Our data from 586 hospitals across the country indicate no significant increase in pulmonary complications throughout the study period, with only slight increase during the single month of April. After accounting for disease severity, this difference became insignificant.

Conclusions

In conclusion, data from these studies reveal deferral of care in patients with diverticular disease during the COVID-19 pandemic. Patients who did seek care for diverticulitis experienced no additional respiratory complications. Given that postoperative pulmonary complications occur in half of patients with perioperative COVID-19 infection, regardless of whether the diagnosis is made with laboratory-confirmation or due to clinical signs, these data can be used to reassure patients needing surgery [24]. Some have advocated that during COVID-19 outbreaks, consideration should be given for postponing non-critical procedures [25]. However, as we prepare for future waves of COVID cases, these studies may help us answer questions related to patient safety while reassuring our patients regarding surgical care. Awareness of community COVID-19 prevalence, testing, as well as patient and provider preparedness are critical elements of surgical care during respiratory pandemics.

References

  1. Cucinotta D, Vanelli M (2020) WHO Declares COVID-19 a Pandemic. Acta Biomed 91: 157-160. [crossref]
  2. WHO Director-Generalโ€™s opening remarks at the media briefing on COVID19 – March 2020.
  3. Healthcare Facilities: Managing Operations During the COVID-19 Pandemic. National Center for Immunization and Respiratory Diseases (NCIRD), Division of Viral Diseases.
  4. Schrag D, Hershman DL, Basch E (2020) Oncology practice during the COVID-19 pandemic. JAMA 323: 2005-2006. [crossref]
  5. van de Haar J, Hoes LR, Coles CE, Seamon K, Frohling S, et al. (2020) Caring for patients with cancer in the COVID-19 era. Nat Med 26: 665-671. [crossref]
  6. Sharpless N (2020) COVID-19 and cancer. Science 368: 1290.
  7. Premier Data. Available at https://products.premierinc.com/downloads/PremierHealthcareDatabaseWhitepaper.pdf
  8. Charlson M, Wells MT, Ullman R, King F, Shmukler C (2014) The Charlson comorbidity index can be used prospectively to identify patients who will incur high future costs. PloS One 9: e112479. [crossref]
  9. Siegler JE, Heslin ME, Thau L, Smith A, Jovin TG (2020) Falling stroke rates during COVID-19 pandemic at a comprehensive stroke center. Journal of Stroke and Cerebrovascular Diseases 29: 104953.
  10. Garcia S, Albaghdadi MS, Meraj PM, Schmidt C, Garberich R, et al. (2020) Reduction in ST-segment elevation cardiac catheterization laboratory activations in the United States during COVID-19 pandemic. J Am Coll Cardiol 75: 2871-2872. [crossref]
  11. Bullrich MB, Fridman S, Mandzia JL, Mai LM, Khaw A, et al. (2020) COVID-19: Stroke Admissions, Emergency Department Visits, and Prevention Clinic Referrals. Canadian Journal of Neurological Sciences 47: 693-696. [crossref]
  12. Morelli N, Rota E, Terracciano C, Immovilli P, Spallazzi M, et al. (2020) The baffling case of ischemic stroke disappearance from the casualty department in the COVID-19 era. Eur Neurol 83: 213-215. [crossref]
  13. Kansagra AP, Goyal MS, Hamilton S, Albers GW (2020) Collateral effect of Covid-19 on stroke evaluation in the United States. New England Journal of Medicine 383: 400-401. [crossref]
  14. Solomon MD, McNulty EJ, Rana JS, Leong TK, Lee C, et al. (2020) The Covid-19 pandemic and the incidence of acute myocardial infarction. New England Journal of Medicine 383: 691-693. [crossref]
  15. Kim HS, Cruz DS, Conrardy MJ, Gandhi KR, Seltzer JA, et al. (2020) Emergency department visits for serious diagnoses during the COVID-19 pandemic. Acad Emerg Med 27: 910-913. [crossref]
  16. Westgard BC, Morgan MW, Vazquez-Benitez G, Erickson LO, Zwank MD (2020) An analysis of changes in emergency department visits after a state declaration during the time of COVID-19. Ann Emerg Med 76: 595-601. [crossref]
  17. Jeffery MM, Dโ€™Onofrio G, Paek H, Platts-Mills TF, Soares WE, et al. (2020) Trends in emergency department visits and hospital admissions in health care systems in 5 states in the first months of the COVID-19 pandemic in the US. JAMA Intern Med 180: 1328-1333. [crossref]
  18. Czeisler Mร‰, Marynak K, Clarke KE, Salah Z, Shakya I, et al. (2020) Delay or Avoidance of Medical Care Because of COVID-19โ€“Related Concerns–United States, June 2020. MMWR Morb Mortal Wkly Rep 69: 1250-1257.
  19. Coster JE, Turner JK, Bradbury D, Cantrell A (2017) Why do people choose emergency and urgent care services? A rapid review utilizing a systematic literature search and narrative synthesis. Acad Emerg Med 24: 1137-1149. [crossref]
  20. English W, Bedwani NB, Smith C, Doganay E, Marsden M, et al. (2020) Suspected appendicitis and COVID-19, a change in investigation and management-a multicentre cohort study. Langenbecks Arch Surg 406: 357-365. [crossref]
  21. Fu SJ, George EL, Maggio PM, Hawn M, Nazerali R (2020) The Consequences of Delaying Elective Surgery: Surgical Perspective. Ann Surg 272: e79-e80. [crossref]
  22. Vogel TR, Dombrovskiy VY, Lowry SF (2010) In-hospital delay of elective surgery for high volume procedures: the impact on infectious complications. J Am Coll Surg 211: 784-790. [crossref]
  23. Mowbray NG, Ansell J, Horwood J, Cornish J, Rizkallah P, et al. (2020) Safe management of surgical smoke in the age of COVID-19. Br J Surg 107: 1406-1413. [crossref]
  24. COVID Surg Collaborative (2020) Mortality and pulmonary complications in patients undergoing surgery with perioperative SARS-CoV-2 infection: an international cohort study. Lancet 396: 27-38.
  25. American College of Surgeons. COVID-19: guidance for triage of non-emergent surgical procedures. https://www.facs.org/covid-19/clinical-guidance/triage. Date: March 17, 2020.