DOI: 10.31038/MGJ.2023611

Abstract

Prostate cancer (CaP) is a public health problem among men worldwide, particularly those over the age of 50, and its incidence continues to rise. Despite improvements in early detection methods, a large proportion of patients succumb to the disease. Studies have shown that men with BRCA1/BRCA2 gene mutations in prostate cancer are likely to have more severe disease and a poorer prognosis. A BRCA2 gene mutation is known to confer the highest risk of prostate cancer (8.6 times in men ≤ 65 years of age) while BRCA1 presents an increased risk, albeit to a lesser extent (3.5 times); making BRCA genes a conceivable genomic biomarker for prostate cancer risk. It is in this context that we will examine the impact of BRCA1/BRCA2 gene mutations in prostate cancer in Thiès. Our study is conducted between January 2020 and December 2022 with 59 patients diagnosed with a prostate tumor in the urology department of the Thiès regional hospital and the Saint Jean de Dieu hospital in Thiès. The variables studied were age, PSA levels, Gleason score and histological grades. Total DNA from prostate tissue was extracted using the Qiagen protocol (Qiagen Dneasy Tissue Kit) and the three primers for the BRCA1-185delAG, BRCA1-5382insC and BRCA2-6174delT genes were amplified. The results indicate a frequency of 62.71% of patients diagnosed with prostate cancer versus 37.29% with the lesion of benign prostatic hyperplasia. BRCA1-5382insC and BRCA2-6174delT mutations showed higher frequencies (2-3 fold) in patients with CaP than in those with the BPH lesion, with 62.7% vs. 37.3% and 65.1% vs. 34.9% respectively. Gleason score 8 was more represented with a rate of 44% corresponding to grade IV according to WHO-ISUP 2016. However, individuals carrying mutations (BRCA1-5382insC; BRCA2-6174DelT) could be associated with a higher risk of prostate cancer, and are also likely to have a poor survival rate.

Keywords

Prostate cancer; Mutations; BRCA1, BRCA2

Introduction

Prostate cancer (CaP) is the second most common cancer diagnosis in men (14.1%) and the fifth leading cause of death (6.8%) worldwide in 2020 [1]. Every year, Africa records around 1.1 million new cases of cancer and up to 700000 deaths from the disease [2]. Many men with prostate cancer are diagnosed by a biopsy and analysis of the prostate, a prostate specific antigen (PSA) test and a digital rectal examination. Risk factors for prostate cancer include family risk, ethnicity, age, obesity and other environmental factors [3]. Demographic expansion and improved life expectancy worldwide are expected to contribute to an increase in the number of cases of CaP [4]. making it a major global health problem. Prostate cancer is a heterogeneous disease, both epidemiologically and genetically. The interaction between genetics, environmental and social influences results in lower estimates of prostate cancer survival rates by race, which explains the differences observed in the epidemiology of prostate cancer in different countries [3]. There is documented evidence of a genetic contribution to prostate cancer. Hereditary prostate cancer and genetic predisposition to prostate cancer have been studied for years. One of the most predisposing genetic risk factors for prostate cancer is family inheritance. Twin studies and epidemiological studies have both demonstrated the role of heredity in CaP [5]. Many researchers have investigated the possible role of genetic variations in androgen biosynthesis and metabolism, as well as the role of androgens [6,7]. Genomics research has identified molecular processes that lead to certain cancerous developments, such as chromosomal rearrangements [3]. Although new treatments have emerged in the last decade, prostate cancer is still a major source of cancer deaths in men [8]. Advanced age is the main risk factor, with more than three-quarters of CaP detections made in men over 65 [9]. Prostate cancer susceptibility genes are genes involved in the androgen pathway and testosterone metabolism. The development of the prostate epithelium and prostate cancer cells depends on the androgen receptor and testosterone signalling pathway [10]. The identification of cancer biomarkers and the targeting of specific genetic mutations can be used for the targeted treatment of prostate cancer. Biomarkers that can be used for targeted therapy include tumour biomarkers, DNA biomarkers and general biomarkers [11]. Family history and genetic predisposition such as BRCA1/BRCA2 pathogenic variants have also been identified as important risk factors [12,13]. It is known that a mutation in the BRCA2 gene confers the highest risk of prostate cancer in men (8.6 times higher in men aged 65 years, while BRCA1 shows increased risk, although to a lesser extent (3.5 times) [14]. These genes have attracted much attention from researchers, but their role in the clinical assessment and treatment of prostate cancer remains complex. The aim of this study is to examine the impact of BRCA1/BRCA2 gene mutations in prostate cancer in Thiès.

Materials and Methods

This study covers 59 patients with prostate tumours. These patients were recruited from the urology department of the Thiès regional hospital and the Saint Jean de Dieu hospital in Thiès between January 2021 and December 2022. Inclusion criteria were a suspicious digital rectal examination (DRE) with a PSA level greater than 4 ng/ml, followed by biopsies for histopathological diagnosis. After review in accordance with the rules laid down by Senegal’s National Health Research Ethics Committee (SNHREC) and in compliance with the procedures established by Cheikh Anta Diop University in Dakar (UCAD) for all research involving human participants, ethical approval was obtained for this study. The objectives of the study, the protocol, the benefits and the confidentiality criteria were explained to each patient to give them the opportunity to accept or refuse to take part. In the case of acceptance, a duly completed and signed informed consent form was required for admission to the study. For data collection, we collected demographic data (surname, first name, age, ethnicity, reason for consultation), PSA levels and medical history from routine family files.

DNA Extraction and Amplification of the BRCA1 and BRCA2 Genes

Total DNA from each sample was extracted using the Qiagen protocol (Qiagen Dneasy Tissue Kit). DNA quality was checked by electrophoretic migration on a 1.5% agarose gel. For a given gene, the conditions for DNA amplification are the same whatever the pathology and for both tumour tissues and controls. PCR amplification conditions included a 1st step of a 12 minute of initial denaturation at a temperature of 95°C, followed by a 2nd step consisting of 35 cycles of 15 seconds of denaturation and hybridization at 94°C and 57°C respectively, primer elongation at 72°C/1 minute, and a 3rd step: final elongation or polymerization at 72°C for 5 min. PCR products were checked by electrophoretic migration on 1.5% agarose gel from 5 μl of amplicons. The size of each amplified gene was estimated using a 500 bp SmartLadder size marker.

The primer sequences and corresponding amplicon sizes are shown in Table 1.

Three founder mutations in the BRCA1 and BRCA2 genes were identified for PCR: 185delAG in exon 2 and 5382insC in exon 20 of the BRCA1 gene, and 6174delT in exon 11 of the BRCA2 gene [15-17]. Germline mutations in the BRCA1 and BRCA2 genes have been reported in several studies of different ethnic populations [16,18,19]. For each mutation, three primers (one common, one specific for the mutant and one specific for the wild-type allele) were used. The competing mutant and wild-type primers were designed to differ in size by 20 bp, allowing easy detection of the PCR products by routine electrophoresis. Both the mutant (long) and wild-type (short) primers contain a mismatched base sequence near the 3′ end. The long (mutant) primer also incorporates two additional mismatched bases at two contiguous positions corresponding to the 5′ end of the short (wild-type) primer. During the final cycles of the PCR reaction, heteroduplexes can be formed from the short and long products, but the contiguous mutagenic sequences in the long product prevent the short product from being filled in using the long strand as a template. If a mutation is present in one of the alleles, two bands will be present. PCR conditions were optimised for each primer pair and applied uniformly to all samples. Amplifications were performed in a reaction volume of 25 μl. The composition of the reaction mixture is given in Table 2.

Table 1: Primers used

Primers	Primers sequences	Amplicon size
	BRCA1-del185AG
Foward	5′ggttggcagcaatatgtgaa 3′
Reverse wild	5′gctgacttaccagatgggactctc 3′	335pb
Reverse mutant	5′cccaaattaatacactcttgtcgtgacttaccagatgggacagta 3 ′	354pb
	BRCA1-5382insC
Foward wild	5′aaagcgagcaagagaatcgca 3′	271pb
Foward mutant	5′aatcgaagaaaccaccaaagtccttagcgagcaagagaatcacc3′	295pb
Reverse	5′gacgggaatccaaattacacag 3′
	BRCA2-6174delT
Foward wild	5′gtgggatttttagcacagctagt 3′	151pb
Foward mutant	5′cagtctcatctgcaaatacttcagggatttttagcacagcatgg 3′	171pb
Reverse	5′agctggtctgaatgttcgttact 3′

Table 2: Composition of the PCR reaction medium for each gene

Volume to be sampled for a PCR with a reaction volume of 25 μl.
Reagents	Gènes amplifiés
	BRCA1-185delAG	BRCA1-5382insC	BRCA2-6174delT
Water	8,75 μl	8,75 μl	8,25 μl
Master mix	12,5 μl	12,5 μl	12,5 μl
Fw	0,25 μl	0,25 μl	0,25 μl
Fm	0,25 μl	0,25 μl	0,25 μl
R	0,25 μl	0,25 μl	0,25 μl
Mgcl2	1 μl	1 μl	1,5 μl

Results and Discussion

Results

For 59 patients recruited, 37 (62.71%) were diagnosed with prostate cancer (CaP) and 22 (37.29%) with benign prostatic hyperplasia (BPH). With regard to the BRCA1 (185delAG and 5382insC) and BRCA2-6174delT mutations, the frequency of BRCA1-185delAG mutations in patients with CaP was 40% compared with 60% in those with a BPH lesion, indicating that this mutation shows no significant difference in men with CaP and probably does not contribute to the incidence of this cancer. However, the other two BRCA1-5382insC and BRCA2-6174delT mutations showed higher frequencies (2 to 3 times) in patients with CaP than in those with the BPH lesion, with respectively 62.7% versus 37.3% and 65.1% versus 34.9%. For individuals with adenocarcinoma of the prostate, most cases had a Gleason score greater than or equal to 7 (87%); with 13% of individuals having a Gleason score equal to 6. Gleason scores for prostate tumours were classified into subgroups <7 and ≥7. This threshold was chosen based on clinical experience and previous literature suggesting that the clinical outcome for prostate cancer of Gleason score 7 is more similar to that of Gleason score 8 to 10 than for Gleason score <7 disease2 [20]. Table 3 shows the association between Gleason scores and BRCA1/BRCA2 mutations. Individuals with cape with BRCA1/2 germline mutations were more frequently associated with Gleason score ≥ 8, at stage T3/T4. BRCA1-5382insC and BRCA2-6174delT mutation carriers conferred a 2 to 3-fold increased risk of high-grade prostate cancer. Although the BRCA1-185delAG mutation has not been associated with prostate cancer, it may be associated with high Gleason score tumours. These results must be carefully taken into account in genetic counselling.

Table 3: Association between Gleason scores and BRCA1 /BRCA2 mutations

Gleason score/BRCA mutations	BRCA1-185delAG	BRCA1-5382insC	BRCA2-6174delT
	N individuals	N individuals	N individuals
Gleason score 6	0	5	4
Gleason score 7	4	12	9
Gleason score 8	6	13	11
Gleason score 9	0	2	2

Discussion

When analysing the genetics of CaP, it is essential to distinguish between localised, high-risk and metastatic disease. Firstly, due to the widespread adoption of PSA, the majority of new CaP diagnoses are low-grade localised disease with an excellent prognosis. These diagnoses are clinically distinct from the comparatively fewer diagnoses of advanced metastatic CaP [21] which are known to have the potential for a poor outcome. Several studies have shown that the genomic/genetic landscape of metastatic castration-resistant CaP (mCRPC) is different from that of localised [22,23]. It is difficult to obtain meaningful clinical predictions by examining CaP as a whole, given the great clinicopathological heterogeneity of the disease. This can be illustrated by germline mutations in BRCA2 which have been underestimated as a driver of hereditary prostate cancers. Genomic profiling of CaP was initially extrapolated from material acquired during unselected prostatectomies and genetic abnormalities were therefore considered rare [24]. As a result, verification bias prevented reporting the true prevalence of pathogenic genetic mutations in advanced metastatic cape. This work was designed to assess the impact of BRCA 1 and BRCA 2 mutations in prostate cancer in the Thiès region with the association of the three founder mutations BRCA1-185delAG and BRCA1-5382insC and BRCA2-6174delT. This study revealed that the highest frequency of BRCA1 mutations in CaP patients was BRCA1-5382insC (62%) followed by BRCA1 185-delAG (40%). The frequency of BRCA1 mutations in patients with a BPH lesion was 60% for BRCA1-185delAG and 38% for BRCA1-5382insC. In addition, the global BRCA2-6174delT mutation was identified in 65.1% of patients with cape versus 34.9% of those with a BPH lesion. These results suggest that the BRCA2-6174delT and BRCA1-5382insC mutations are likely to contribute to the incidence of prostate cancer in the Thiès region, which is not the case for the BRCA185-delAG mutation, which shows no significant difference in patients with CaP. Our results are comparable to those of Gallagher et al. in 2010 [24] and Agalliu et al. in 2009 [25] where they found mutation frequencies for the BRCA1-5382insC and BRCA2-6174delT genes to be largely predominant in individuals with CaP. Studies of breast cancer by Abou El Naga et al. reported contradictory results, with the two mutations (BRCA1-5382insC and BRCA2-6174delT) showing higher frequencies in healthy controls than in breast cancer patients [26]. In addition, we found that the risk of prostate cancer associated with carrying these mutations was higher in men diagnosed at an older age (65 or over) and in particular in those with the BRCA2-6174delT and BRCA1-5382insC mutations.

A number of previous studies have examined the associations between these BRCA1/BRCA2 mutations and prostate cancer [17,28-30]. Struewing et al. [27] estimated a lifetime risk of CaP of 16% for BRCA1/BRCA2 mutation carriers and 3.8% for non-carriers. Our results reported that BRCA2-6174delT and BRCA1-5382insC mutation carriers had two to three times the risk of prostate cancer, and as indicated here, the BRCA1-185delAG mutation was not associated with prostate cancer. Our results contradict those of Giusti et al. [30] who found the BRCA1-5382insC mutation not to be associated with prostate cancer. The absence of a detectable effect for the BRCA1-185delAG mutation could be linked to its low prevalence in the population, or to the effects of allelic heterogeneity. In support of a role for prostate cancer-associated BRCA2 mutations, studies of breast and/or ovarian cancer families harbouring disease-associated BRCA2 mutations have reported that male family members carrying such mutations have an increased risk of prostate cancer [31-33]. A Finnish study [34] of breast and/or ovarian cancer families also reported a 5-fold increase in the risk of prostate cancer in men carrying BRCA2 protein-truncating mutations. First-degree male relatives of breast cancer patients with protein-truncating BRCA2 mutations had a 4.8% risk of prostate cancer [35]. In 2012, studies by Castro et al. [36] reported that BRCA2 mutation status was found to be an independent predictor of median cause-specific survival. Interestingly, the non-carrier group also had a poorer outcome than other sporadic CaP series, suggesting that a family history of breast cancer could somehow affect the prognosis of prostate cancer patients.

In the present study, a major proportion of mutation carriers had a Gleason score ≥ 7 (87%); our results are similar to those of Gallagher et al. in 2010 [24] where 85% of mutation carriers had Gleason disease ≥7. Our results were striking, with 22 of 26 (84.6%) BRCA2-6174delT mutation carriers and 27 of 32 BRCA1-5382insC mutation carriers (84.3%) showing Gleason disease ≥7, representing a group with an aggressive phenotype and confirming this association reported by Agalliu et al. [25]. However, individuals carrying these two mutations may be associated with a higher risk of prostate cancer and are also likely to have poor survival as reported by Edwards et al. in 2010 [37]. This is also reflected in the study by Kote-Jarai et al. where the proportion of high grade CaP (Gleason score ≥ 8) was 63% significantly elevated [14].The study by Gallagher et al. reported that BRCA2 mutation carriers had an increased risk of CAP and a higher histological grade and that BRCA1 or BRCA2 mutations were associated with a more aggressive clinical course [24] results confirmed by studies by Castro et al. in 2013 in a large retrospective cohort [38].

Conclusion

Prostate cancer is the second most common cancer in men worldwide and is a complex heterogeneous disease with high heritability. Our results showed that BRCA2-6174delT and BRCA1-5382insC mutations are strongly associated with a very aggressive form of prostate cancer. Molecular characterisation of CaP patients should be systematically integrated into healthcare structures in order to select patients who are more likely to respond to targeted agents. In addition, in the event of a family history of hereditary breast cancer (± hereditary ovarian cancer), it is recommended that the patient be referred to an oncogenetic consultation to look for a mutation in the BRCA1 and BRCA2 genes. In the case of aggressive prostate cancer (high Gleason score or locally advanced or metastatic stage) in a patient under the age of 50, it is recommended that the patient be referred to an oncogenetic consultation to look for a mutation in the BRCA2 and HOXB13 genes (level of evidence 2a) [39]. Further clinical trials would be needed to assess the impact of genomic nuances in reducing the morbidity and mortality prevalent with prostate cancer.

Acknowledgement

The authors are very grateful to the patients who participated in this study. We are extremely grateful to Dr Modou Faye who helped for sample collection. Also Pr SEMBENE, head of the genomics laboratory for all the molecular studies carried out and Pr Tonleu Linda Bentefouet, head of the cytological and pathological anatomy unit for the histopathological diagnoses.

Conflict of Interest

The authors have declared no conflicts of interest.

References

1. Sung H Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. (2021) Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71: 209-249. [crossref]
2. Santé OMdl Cancer. 2022. Available from: https: //www.who.int/fr/news-room/fact-sheets/detail/cancer.
3. Hjelmborg JB, Scheike T, Holst K, Skytthe A, Penney KL, et al. (2014) The Heritability of Prostate Cancer in the Nordic Twin Study of Cancer. Cancer Epidemiol. Biomark Prev 3: 2303-2310. [crossref]
4. Ferlay J, Ervik M, Lam F (2018) Global Cancer Observatory: Cancer Today; International Agency for Research on Cancer: Lyon, France.
5. Termini D, Hartogh DJD, Jaglanian A, Tsiani E (2020) Curcumin against Prostate Cancer: Current Evidence. Biomolecules 10. [crossref]
6. Wen S, Chang HC, Tian J, Shang Z, et al. (2015) Stromal Androgen Receptor Roles in the Development of Normal Prostate, Benign Prostate Hyperplasia, and Prostate Cancer. Am J Pathol 185: 293-301. [crossref]
7. Cittadini A, Isidori AM, Salzano A (2021) Testosterone therapy and cardiovascular diseases. Cardiovasc Res 118: 2039-2057. [crossref]
8. Rawla P (2019) Epidemiology of Prostate Cancer. World J Oncol 10: 63-89. [crossref]
9. Parkin DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA Cancer J Clin 55: 74-108. [crossref]
10. Bluemn EG, Nelson PS (2012) The androgen/androgen receptor axis in prostate cancer. Curr Opin Oncol 24: 251-257. [crossref]
11. Ziaran S, Novakova ZV, Böhmer D, DanišoviˇcL (2015) Biomarkers for determination prostate cancer: Implication for diagnosis and prognosis. Neoplasma 62: 683-691. [crossref]
12. Patel AR, Klein EA (2009) Risk factors for prostate cancer. Nat Clin Pract Urol 6: 87-95.
13. Messina C, Cattrini C, Soldato D, Vallome G, Caffo O, et al. (2020) BRCA Mutations in Prostate Cancer: Prognostic and Predictive Implications. J Oncol 2020: 4986365. [crossref]
14. Kote-Jarai Z, Leongamornlert D, Saunders E, Tymrakiewicz M, Castro E, et al. (2011) BRCA2 is a moderate penetrance gene contributing to young-onset prostate cancer: Implications for genetic testing in prostate cancer patients. Br J Cancer 105: 1230-1234. [crossref]
15. Ewald IP, Izetti P, Vargas FR, Moreira MA, Moreira AS, et al. (2011) Prevalence of the BRCA1 founder mutation c.5266dupin Brazilian individuals at-risk for the hereditary breast and ovarian cancer syndrome. Hered. Cancer Clin Pract 9.
16. Abeliovich D, Kaduri L, Lerer I, Weinberg N, Amir G, et al. (1997) The founder mutations 185delAG and 5382insC in BRCA1 and 6174delT in BRCA2 appear in 60% of ovarian cancer and 30% of earlyonset breast cancer patients among Ashkenazi women. Am J Hum Genet 60: 505-514. [crossref]
17. Ford D, Easton DF, Stratton M, Narod S, Goldgar D, et al. (1998) Mar. Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. The breast cancer linkage consortium. Am J Hum Genet 62: 676-689. [crossref]
18. Neuhausen SL, Ozcelik H, Southey MC, John EM, Godwin AK, et al. (2009) Breast Cancer Family Registry. BRCA1 and BRCA2 mutation carriers in the Breast Cancer Family Registry: an open resource for collaborative research. Breast Cancer Res Treat 116: 379-386. [crossref]
19. Hartwig M, Janiszewska H, Bąk A, Pilarska M, Heise M, et al. (2013) Prevalence of the BRCA168_69delAG (BIC: 185delAG) mutation in women with breast cancer from north-central Poland and a review of the literature on other regions of the country. Contemp Oncol (Pozn) 17: 34-37.
20. Thompson KE, Hernandez J, Canby-Hagino ED, Troyer D, Thompson IM (2005) Prognostic features in men who died of prostate cancer. J Urol 174: 553-556; discussion 56. [crossref]
21. NCCN Clinical Practice Guidelines in Oncology. Prostate Cancer Version 2.2031; National Comprehensive Cancer Network: Plymouth Meeting, PA, USA, 2021.
22. Robinson D, Van Allen EM, Wu YM, Schultz N, Lonigro RJ, et al. (2015) Integrative clinical genomics of advanced prostate cancer. Cell 161: 1215-1228. [Crossref]
23. Network CGAR (2015) The Molecular Taxonomy of Primary Prostate Cancer. Cell 163: 1011-1025. [crossref]
24. Gallagher DJ, Gaudet MM, Pal P, Kirchhoff T, Balistreri L, et al. (2010) Germline BRCA mutations denote a clinicopathologic subset of prostate cancer. Clin Cancer Res 16: 2115-2121. [crossref]
25. IlirAgalliu, Robert Gern, Suzanne Leanza, Robert DB (2009) Associations of High-Grade Prostate Cancer with BRCA1 and BRCA2 Clin Cancer Res15 February 1, 2009.
26. Amoura Abou-El-Naga, Ahmed Shaban, Hayam Ghazy, Afaf Elsaid, Rami Elshazli, Ahmad Settin (2018): Frequency of BRCA1 (185delAG and 5382insC) and BRCA2 (6174delT) mutations in Egyptian women with breast cancer compared to healthy controls, Meta Gene 15: 35-41.
27. Struewing JP, Hartge P,Wacholder S, et al. (1997) The risk of cancer associated with specific mutations of BRCA1 and BRCA2 among Ashkenazi Jews. NEngl J Med 336: 1401-1408. [crossref]
28. Kirchhoff T, Kauff ND, Mitra N, et al. (2004) BRCA mutations and risk of prostate cancer in Ashkenazi Jews. Clin Cancer Res ;10: 2918-21. [crossref]
29. Vazina A, BanielJ, ShtrikerA, et al. (1999) The prevalence of the major Jewish mutations BRCA1 and BRCA2 in prostate cancer patients in Israel. J Urol 161: 55-56. [crossref]
30. Giusti RM, Rutter JL, Duray PH, et al. (2003) A twofold Iicrease in Brca mutation related prostate cancer among Ashkenazi Israelisisn ot associated with distinctive histopathology. J Med Genet 40: 787-792. [crossref]
31. The Breast Cancer Linkage Consortium. Cancer risks in BRCA2 mutation carriers (1999). J Natl Cancer Inst 91: 1310-1316.
32. Van Asperen CJ, Brohet RM, Meijers-Heijboer EJ, Hoogerbrugge N,Verhoef S (2005) Cancer risks in BRCA2 families: estimates for sites other than breast and ovary. JMed Genet 42: 711-719. [crossref]
33. Thompson D, Easton DF (2002) Breast Cancer Linkage Consortium. Cancer incidence in BRCA1mutation carriers. JNatl Cancer Inst 94: 1358-1365. [crossref]
34. Eerola H, Pukkala E, Pyrhonen S, et al. (2001) Risk of cancer in BRCA1 and BRCA2 mutation positive and-negative breast cancer families (Finland). Cancer Causes Control 12: 739-746. [crossref]
35. Tulinius H, Olafsdottir GH, Sigvaldason H, et al. (2002) The effect of a single BRCA2 mutation on cancer in Iceland. JMed Genet 39: 457-462. [crossref]
36. Elena Castro, Rosalind Eeles (2012) The role of BRCA1 and BRCA2 in prostate cancer. Asian Journal of Andrology 14: 409-414. [crossref]
37. Edwards SM, Evans DG, Hope Q, Norman AR, Barbachano Y, et al. (2010) Prostate cancer in BRCA2 germline mutation carriers is associated with poorer prognosis. Br J Cancer 103: 918-924. [crossref]
38. Elena Castro, Chee Goh, David Olmos, Ed Saunders, Daniel Leongamornlert, et al. (2013) Germline BRCA Mutations Are Associated With Higher Risk of Nodal Involvement, Distant Metastasis, and Poor Survival Outcomes in Prostate Cancer. J Clin Oncol 31: 1748-1757. © by American Society of Clinical Oncology.
39. Rozeta F, Hennequin C, Beauval JB, Beuzeboc P, Cormier L, et al. (2018-2020) Recommandations françaises du comité de cancérologie de l’AFU-Actualisation.